Hum Genet (1994) 93:359-360 human ii genet,cs 9 Springer-Verlag 1994 Three CA/GT repeat polymorphisms from loci D21S414 and D21S1234 on human chromosome 21 Assumpci6 Bosch l, Stefan Wiemann 2, Wilhelm Ansorge 2, David Patterson 3, Xavier Estivill 1 Molecular Genetics Department, Cancer Research Institute (IRO), Hospital Duran i Reynals, L'Hospitalet de Llobregat, E-08907 Barcelona, Catalunya, Spain 2EMBL, Meyerhofstrasse 1, D-69117 Heidelberg, Germany 3Eleanor Roosevelt Institute, 1899 Gaylord Street, Denver, CO 80206, USA Received: 18 August 1993 /Revised: 31 August 1993 Abstract. We report three new polymorphic CA repeat microsatellites (ABM-21, ABM-C37A, and ABM-C37B) in two different loci (D21S414 and D21S1234), located in bands q21 and qll.2 of human chromosome 21 (HC21) and that were isolated from a HC21 phage library (LA21NS01). Heterozygosities for ABM-21, ABM- C37A, and ABM-C37B were 0.74, 0.50, and 0.67 respec- tively. These three CA repeat markers should be useful in the construction of a high resolution genetic map of this region of HC21. Sequence information. An EcoRI human chromosome 21 (HC21) phage library (LA21NS01) has been screened us- ing a (GT)10 oligonucleotide (Bosch et al. 1993). Positive clones have been subcloned into pUC18, and M13 primers have been used to sequence the regions flanking Correspondence to: X. Estivill the CA repeats using an automatic DNA sequencer. The repeat sequences reported here consisted of simple CA re- peats of 20 and 19 dinucleotides for ABM-C21 and ABM- C37A respectively, and a complex repeat of (CT)9(GT)]8 for ABM-C37B (EMBL accession numbers Z22789, Z22793, and Z25523). ABM-C37A and ABM-C37B are two different CA repeats isolated from the same clone (ABM-C37). Primers flanking the repeats have been de- signed allowing the analysis of these polymorphisms by the polymerase chain reaction (PCR). Table 1 shows the sequence of these primers, the D-number assigned to each clone, and the length of the PCR product. PCR conditions. The conditions for PCR were: 1.5 mM for the 7-32p 5" labelled primer, 10 mM for the unlabeled primer, 1.8 mM MgC12, 60 mM KC1, 200 mM of each dNTP (final concentrations) and 100 ng DNA in 25 gl, at 92~ for 6 min, 28 cycles of 95~ for 20 s, 56~ for 20 s for ABM-C21, 58~ for 20 s for ABM-C37A and ABM- C37B, and 74~ for 20 s, with a final extension of 5 min Table 1. Primers used to analyze the three polymorphic CA repeat microsatellites re- ported in this paper D-number Marker name PCR Primer sequences product length (bp) D21 $414 ABM-C2I 164-176 D21S 1 2 3 4 ABM-C37A 131-163 D21S 1 2 3 4 ABM-C37B 137-143 ABM-C21D 1 GACAGTTFAGAGCAAGTGACA ABM-C21R1 CTTTAGGAGAAGTAATCGTCTT ABM-C37AD1 CTGCCTTTGGAATAAATGCATA ABM-C37AR1 GTAGGGAACAGCAACAGCAT ABM-C37BD1 CCTGCTGCCTGCTTTGGACTTA ABM-C37BR1 CCTGATTTGTCTTTCATCTCG