Submit Manuscript | http://medcraveonline.com Introduction The general idea that emerged from the experiments, made in our laboratory, was that Echinodermata, as exemplifed, by sea star Aste- rias rubens (Asterids)and by Ophiocomina nigra (Ophuirids), posses- sed an immune system, able to mount cellular and humoral-specifc responses. After stimulation with a foreign antigen:the horse-radish peroxydase(HRP). 1,2 Then,these echinodermata produced a primitive antibody, correlated to an Igkappa gene 3–5 to a Fab gene, 6 a Fc receptor gene. 7 But a question desserves to be put: did the ancestral Echino- dermata, Antedon bifda, (Crinoïd) possess such genes? It is why, in a frst time, we look for IgKappa gene, Fab gene, Fc receptor gene in this crinoïd by the mean of genomic studies. Materials and methods a. Animals: Antedon bifda was obtained at the station « Of Bio- logie Marine of Roscoff » France. b. Obtention of crinoïd mRNA: Digestive coeca were excised from the A. bifda body. A. bifda mRNA was obtained from Uptizol (Interchim). Quality control was operated. c. Sequencing: Sequencing was made on Illumina Next Seq 500 with paired-end : 2. 75 bp Transcriptome was assembled from RNA-Seq fastq fles using Tri- nity v2.1.1 ( 8 with default parameters. A BLAST database was created with the assembled transcripts using makeblastdb application from ncbi-blast+ (v2.2.31+). The sequences of transcripts of interest were then blasted against this database using blastn application from ncbi- -blast+ 9 with parameter word_size 7. d. Results: The Table 1 which is following summarizes the found Antedon bifda transcriptomes of Igkappa gene and Fc receptor gene of IgA (FCAR) of IgE (Fcer2a) we met in Homo sapiens and in Mus musculus: The Antedon bifda IgK transcriptome sequence is the one: >TRINITY_DN9178_c0_g1_i2 (Igk): 5’ AGCGAATGAAAAAGAAGAACCGGCCAAA - AAAAGTACTTCTACCAAAGAAGCGAATGAAAA AGAAGAACCGGCCAAAAAAAGTACTTCTAC - CAAAGAAGAAACTGAAATAGAAGAACTAAC CGAAACAAGTATTTCTACAAAATCAGTTTC - TGCCAGTGATATATTCCTTGGTACAACTTT CACACTGGAGATGGGATTCTGCGTAGGACC - TGAACACAAACCGTTTACAGGAGATTTCGA CGGTGACGGTAATGAAGATCTTCTGTTTCA - CAATTCAAAGACAGGCTCGAAAAAGATATA CTATGCAAGTTGTGACGGCTCTTTTAATGG - TGATAGGTCGTGGAGAAGAGAGATGAATTT TTGCTACGTAAGTGGATATGATCTATACAT - TGGTGATTTCAACGGCGATGGTCGATCCGA TATGCTGTGTCATCGTCCTCAGTATGGTCA - GATTTGGGTTGTGTTGGCGCAACCTGGGGG TGTATTCACTGCTAACCCGTGGTCGTATAG - TCCCAATTGGTGCAAGGCCACCACTGATAA AGTATATATTGGAGACTTCAACGCAGACGG - TCGGGATGATATTCTTTGCCACACACAAAG TTCGGGTTACATTGCAATATATTATGCATTA - TACACTGGTTATTTTTCTACCTCTACAAC ATATCGCTTTACACGAAGTATGAGTTGGTG - CAGAGGTACATATCAAAGAGTGTATACTGG AGATTTCAACGGAGACCGAAGGGTTGATA - TGCTCTGCCACGACTACTCATCTGGCTACAT ATATGTAGCAGTAGCCACAGCGACTGGTG - GATTCACCTCTGCCACATGGAGCAGAAGTAT GGGCTGGTGCAAGCATTCGAACTCTAAGC - TCAGCATTGGAGATTTCAATAAAGATAACCG CGACGACATCATGTGCAGCGACACAAATG - GTCCTTACTGGATAGCATTCTCTCTGTACAA CGGTTCGTTTTCATCTAAAAGCTGGACCCG - TAAACAAAACTGGTGTACATCTGGCAATGA J Appl Biotechnol Bioeng. 2018;5(5):303‒304. 303 © 2018 Leclerc et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and build upon your work non-commercially. Evidence of immune genes in the crinoïd: Antedon bifda evidence of A.bifda Igkappa gene and a FC receptor one Volume 5 Issue 5 - 2018 Michel Leclerc, 1 Franck Letourneur, 2 Dominique Davoult, 3 Ariane Jolly, 4 Pierre de la Grange 4 1 556 rue Isabelle Romée, France 2 INSERM, Plate-forme génomique,Institut Cochin, France 3 Université Pierre et Marie Curie, station biologique de Roscoff, France 4 Genosplice, France Correspondence: Michel Leclerc, 556 rue Isabelle Romée, 45640 Sandillon, France, Email mleclerc45@gmail.com Received: July 08, 2018 | Published: October 04, 2018 Abstract Immuno-genomics studies realized in Echinodermata (Invertebrates) were surprising. 3 classes out of 5 Echinodermata presented an IGKappa gene and a Fc receptor gene. It was, first demonstrated, in Asterids and Ophuirids. It was, secondly clearly shown, in the ancestral Crinoïd: Antedon bifida Keywords: invertebrates, echinodermata, crinoïds, igkappa gene, fc gene, A. bifida Journal of Applied Biotechnology & Bioengineering Research Article Open Access