BIODIVERSITAS ISSN: 1412-033X Volume 24, Number 1, January 2023 E-ISSN: 2085-4722 Pages: 241-249 DOI: 10.13057/biodiv/d240129 DNA primer design for sex identification of Sumatran tiger body samples IKRIMA ASRORI, DJONG HON TJONG, WILSON NOVARINO, MANSYURDIN, SYAIFULLAH, DEWI IMELDA ROESMA  Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Andalas. Jl. Raya Unand, Limau Manis, Padang 25163, West Sumatra, Indonesia. Tel./Fax.: +62-751-71671,  email: dewiroesma@sci.unand.ac.id Manuscript received: 15 November 2022. Revision accepted: 4 January 2023. Abstract. Asrori I, Tjong DH, Novarino W, Mansyurdin, Syaifullah, Roesma DI. 2023. DNA primer design for sex identification of Sumatran tiger body samples. Biodiversitas 24: 241-249. Many reports of cases of illegal trade in animal body parts have resulted in more and more samples of animal body parts being seized. Seized sample from illegal trade needs to be identified with the help of molecular methods to ensure the profile of the seized samples including the determination of their sex. At the molecular level, amelogenin gene amplifications are used to determine the sex of mammals. Previous studies using primers for amelogenin gene amplification found that amelogenin X (AMELX) and amelogenin Y (AMELY) bands in male samples were difficult to distinguish due to very small differences, 20 base pairs (bp). The difficulty of distinguishing these bands resulted in errors in detecting male and female individual samples. Therefore, it was to design a more specific primer as a way to avoid this error. The purpose of this study was to design a DNA primer for the sex identification of the Sumatran tiger (Panthera tigris sumatrae Pocock, 1929). The research was carried out using descriptive methods and molecular observation of the AMELX and AMELY Sumatran tiger sequences. The primer design results in this study were 100% able to identify the sex of the Sumatran tiger sample. The present primer design (F= 5’ TCGGTTAACAATTCCCTGGGC’3 and R= 5’AGGCCAAATAGGAGTGTGCT’3) is more specific than the primers previously reported. Keywords: Design primer, gen amelogenin, intron, Panthera tigris sumatrae, specific primer INTRODUCTION The Sumatran tiger is one of nine tiger subspecies (Seidensticker et al. 1999). There used to be three tiger subspecies in Indonesia, but, the Javan tiger (Panthera tigris sondaica Temminck, 1844) and the Balinese tiger (Panthera tigris balica Schwarz, 1912), became extinct in the 1940s and 1980s (Xue et al. 2015). The Sumatran tiger (Panthera tigris sumatrae Pocock, 1929) is an endangered species on the IUCN (International Union for Conservation of Nature) Red List. Although there are already international laws and regional regulations on tiger parts trade, poaching, and illegal activities, many cases continue to this day (Goodrich et al. 2015). The increasing demand for Sumatran tiger body parts and cases of habitat destruction were the main causes of the decline in tiger numbers during the twentieth century. Therefore, monitoring the population of this species is very important. Sex ratio information is important to provide information for animal conservation and management (Joshi et al. 2019). The sex ratio is important to obtain information on the estimated number of males and females caught in illegal hunting, and to estimate the Sumatran tiger population in ecological studies (Colorado et al. 2012). Identification of the sex of an adult Sumatran tiger can be determined by direct observation. However, often the results of confiscations from illegal trade are only body parts in the form of nails, flesh, skin, hair, bones, and other biological materials (Kamarcharya et al. 2018). Therefore, it is necessary to carry out a comprehensive examination to ascertain the profile of the confiscated samples, which are thought to be part of the Sumatran tiger. DNA molecular marker is one of the methods to identify separate from the animal’s bodies. Previous research using molecular methods to identify body part samples, among others, was reported by Ashrifurrahman et al. (2019) that there is a specific site on the 23rd sequence nucleotide base of the COI gene, and then Ashrifurrahman et al. (2022) reported that the COI gene can be used as a marker to identify Sumatran tiger samples. Molecular sex identification can be done by amplifying the amelogenin gene (Gokulakrishnan et al. 2012; Farahvash et al. 2016; Dutta et al. 2017). The amelogenin gene is used for molecular sex identification in mammals. Electrophoresis results from the amplification of the amelogenin gene, indicated by two bands in the male sample, and one band in the female sample (Ahmad et al. 2021; Lucas et al. 2022). Sex identification of the Sumatran tiger based on the amelogenin gene using primers from Pilgrim et al. (2005) has also been reported by Asrori et al. (2022). Asrori et al. (2022) reported that the results of the sex identification of the Sumatran tiger based on Pilgrim et al. (2005) showed that the amelogenin gene amplification bands on the X and Y chromosomes in male samples were difficult to distinguish. the difficulty to distinguish AMELX and AMELY bands due to the difference in the length of the