Life Sciences 316 (2023) 121340 Available online 28 December 2022 0024-3205/© 2022 Elsevier Inc. All rights reserved. Review article The role of microRNA-21 (miR-21) in pathogenesis, diagnosis, and prognosis of gastrointestinal cancers: A review Bahareh Farasati Far a, 1 , Kimia Vakili b, 1 , Mobina Fathi b, 1 , Shirin Yaghoobpoor b, * , Mohammed Bhia c , M. Reza Naimi- Jamal a, * a Department of Chemistry, Iran University of Science and Technology, Tehran, Iran b Student Research Committee, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran c Student Research Committee, Department of Pharmaceutics and Nanotechnology, School of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran, Iran A R T I C L E INFO Keywords: miR-21 Diagnostic biomarker Prognostic biomarker Gastric cancer Colorectal cancer Esophageal cancer Pancreatic cancer ABSTRACT MicroRNAs (miRNAs) are small non-coding RNAs regulating the expression of several target genes. miRNAs play a signifcant role in cancer biology, as they can downregulate their corresponding target genes by impeding the translation of mRNA (at the mRNA level) as well as degrading mRNAs by binding to the 3 ′ -untranslated (UTR) regions (at the protein level). miRNAs may be employed as cancer biomarkers. Therefore, miRNAs are widely investigated for early detection of cancers which can lead to improved survival rates and quality of life. This is particularly important in the case of gastrointestinal cancers, where early detection of the disease could sub- stantially impact patients’ survival. MicroRNA-21 (miR-21 or miRNA-21) is one of the most frequently researched miRNAs, where it is involved in the pathophysiology of cancer and the downregulation of several tumor suppressor genes. In gastrointestinal cancers, miR-21 regulates phosphatase and tensin homolog (PTEN), programmed cell death 4 (PDCD4), mothers against decapentaplegic homolog 7 (SMAD7), phosphatidylinositol 3-kinase /protein kinase B (PI3K/AKT), matrix metalloproteinases (MMPs), β-catenin, tropomyosin 1, maspin, and ras homolog gene family member B (RHOB). In this review, we investigate the functions of miR-21 in pathogenesis and its applications as a diagnostic and prognostic cancer biomarker in four different gastroin- testinal cancers, including colorectal cancer (CRC), pancreatic cancer (PC), gastric cancer (GC), and esophageal cancer (EC). 1. Introduction MicroRNA (miRNA) is a small, non-coding, single-stranded RNA molecule that is around 22 nucleotides in length. It regulates post- transcriptional gene expression by binding to the 3 ′ untranslated re- gion of the target messenger RNA (mRNA) and by either blocking translation of the mRNA or causing its degradation [1]. In the human body, more than 2000 mature miRNAs are encoded in our genome. miRNAs play various roles in cellular functions, such as suppressing apoptosis, proliferation, responding to DNA damage, autophagy, modulating the immune system activity, neovascularization, responding to stress, and the progression of cancer [2–4]. Different miRNAs have crucial roles in tumor progression, including gastrointestinal cancers [5–9]. According to research results, microRNA-21 (miRNA-21 or miR- 21) has a relationship between the progression and occurrence of malignant tumors in solid organs and blood [10,11]. In Homo sapiens, miR-21 (5 ′ UAGCUUAUCAGACUGAUGUUGA3 ′ ) is positioned on 17q23.2 in the intron of the vacuole membrane protein 1 (VMP1)/transmembrane protein 49 (TMEM49) locus in the chromo- some [19]. The considerably conserved and special promoter region of the miR-21 can be activated by activation protein 1 (AP-1) with the help of several other genes. The genomic sequence that encodes miR-21 is transcribed through polymerase II. The transcription will create pri- miRNA with around 3433 nucleotides in length. Then, pre-miR-21 with a length of approximately 72 nucleotides will be formed with the help of the microprocessor complex. After that, pre-miR-21 gets trans- ported to the cytoplasm, where Dicer trims the pre-miR-21 to form miR- 21-3p (CAACACCAGUCGAUGGGCUGU) and miR-21-5p (UAGCUUAU- CAGACUGAUGUUGA). miR-21 can potentially target more than 3000 human genes, and many of these genes have a wide range of roles in * Corresponding authors. E-mail addresses: sh.yaghoobpoor98@gmail.com (S. Yaghoobpoor), naimi@iust.ac.ir (M.R. Naimi- Jamal). 1 These authors contributed equally to the work. Contents lists available at ScienceDirect Life Sciences journal homepage: www.elsevier.com/locate/lifescie https://doi.org/10.1016/j.lfs.2022.121340 Received 26 October 2022; Received in revised form 16 December 2022; Accepted 26 December 2022