41 Am. J. Trop. Med. Hyg., 58(1), 1998, pp. 41–46 Copyright  1998 by The American Society of Tropical Medicine and Hygiene IDENTIFICATION AND GENETIC ANALYSIS OF PANAMA-GENOTYPE VENEZUELAN EQUINE ENCEPHALITIS VIRUS SUBTYPE ID IN PERU M. STEVEN OBERSTE, SCOTT C. WEAVER, DOUGLAS M. WATTS, AND JONATHAN F. SMITH Virology Division, U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, Frederick, Maryland; Center for Tropical Diseases and Department of Pathology, University of Texas Medical Branch, Galveston, Texas; U.S. Naval Medical Research Institute Detachment, Lima, Peru Abstract. Venezuelan equine encephalitis (VEE) virus was isolated in 1993, 1994, and 1995 from human cases of acute, undifferentiated, febrile illness in the Peruvian Amazon Basin. Two virus isolates were recovered in 1994 from Peruvian soldiers at a jungle outpost near Pantoja in northern Peru, and 10 isolates were obtained from military personnel and civilians in 1993–1995 in Iquitos, an urban center in northeastern Peru. The genetic relationship of these isolates to other VEE virus strains was determined by sequencing 856-867 nucleotide reverse transcription– polymerase chain reaction fragments derived from the PE2 glycoprotein gene. The sequences were compared with those of other VEE virus strains, including representatives of the IAB, IC, ID, IE, II, and IIIC subtypes. The two Pantoja isolates were most closely related to subtype IC and ID viruses previously isolated in Colombia and Venezuela, and to the ID viruses isolated during the 1970s in Iquitos. All of the recent Iquitos isolates were similar to one another, but they were more closely related to Panamanian ID strains than to isolates previously obtained in Iquitos, Peru, or in Colombia and Venezuela. The recent Iquitos VEE viral isolates were the first Panama-genotype VEE ID virus strains identified outside of the Republic of Panama. Venezuelan equine encephalitis (VEE) virus subtype IAB was the cause of equine epizootics and epidemic human dis- ease along the Peruvian coastal plains in the 1940s, 1950s, 1969, and 1973. 1, 2 The irregular occurrence of VEE virus epizootics in the mostly dry coastal plains of Peru, coupled with serologic evidence of VEE viral infection among equine and human populations in the Amazon region of Peru, 3 led to speculation that the coastal epizootics were caused by viruses introduced from the Amazon region by infected humans and/or animals. 4, 5 Ecologic surveys aimed at finding the source of the epizootic virus were conducted in the Peruvian Amazon basin in 1970–1971 and 1975 and yielded 11 VEE virus isolates from mosquitoes and sentinel hamsters in Quistococha, near the city of Iquitos. 4, 5 Vene- zuelan equine encephalitis virus was not isolated at two other sites near Iquitos nor at sites near Pucallpa, Yurimaguas, or Imacita. 4, 5 Ten of the Quistococha isolates were shown to belong to subtype ID 5, 6 and the other virus remains the only known isolate of subtype IIIC. 6, 7 The VEE ID virus strains isolated near Iquitos in 1970– 1971 and 1975 were serologically similar to those found in Panama, Venezuela, and Colombia. 4, 5 These ID isolates are serologically and genetically distinguishable from those of Ecuador and the Pacific coast of Colombia (near Tumaco) using monoclonal antibodies 8 or ribonuclease fingerprinting, 9 respectively. Panama ID isolates can be differentiated from the Colombia-Venezuela strains only by nucleotide sequenc- ing and phylogenetic analysis. 10 In addition, Colombia-Ven- ezuela ID strains are phylogenetically related to the epizootic subtype IC strains that have been isolated in Colombia and Venezuela. 10–12 Several VEE ID virus strains have caused human disease in Panama, Colombia, Venezuela, and Ecuador. 13–15 Serologic surveys conducted in 1965, 1970, 1971, and 1975 showed evidence of VEE infection of humans in the Peruvian Am- azon basin, 3–5, 16 but no isolates were made from humans and the subtype of the infecting virus was not determined. In 1993–1995, VEE ID virus was first associated with human disease in the Amazon region of Peru. 17, 18 The VEE virus isolates were obtained from the sera of two patients near Pantoja in 1994, 17 and from 10 patients in and around the city of Iquitos in 1993–1995. 18 One isolate from each of the outbreaks was serologically identified as belonging to sub- type ID (Colombia-Venezuela-Panama serologic group) on the basis of a monoclonal antibody ELISA. 17, 18 Limited nu- cleotide sequence analysis suggested that the Pantoja isolates belonged to the Colombia-Venezuela genotypic group, whereas the Iquitos isolates were of the Panama genotype. The detailed phylogenetic analysis of all known Peruvian enzootic VEE isolates, with comparisons to Panama- and Colombia-Venezuela-genotype VEE ID virus isolates is re- ported here. These analyses show that the two Pantoja iso- lates, as well as the 1970s Iquitos VEE subtype ID virus isolates, belong to the Colombia-Venezuela IC/ID genotypic group. In contrast, the 1993–1995 Iquitos VEE virus isolates belonged to the Panama genotypic group. These results, cou- pled with previous analyses of other ID strains, 10, 11 demon- strated for the first time the presence of Panama-genotype ID strains outside of the Republic of Panama, and suggested that the Panama genotype may have been recently intro- duced into Peru. MATERIALS AND METHODS Viruses and nucleotide sequencing. The VEE virus iso- lates used in phylogenetic analyses are listed in Table 1. The isolation of viruses from clinical specimens in Pantoja and Iquitos has been described in detail elsewhere. 17, 18 Viral RNA was extracted from cell-free supernatants of virus-in- fected Vero cells using Trizol-LS (Life Technologies, Inc., Gaithersburg, MD) by the manufacturer’s recommended pro- cedure. Reverse transcription (RT) and the polymerase chain reaction (PCR) were performed as described previously, 19 using RT primer VEE116 (TACACCCAYTTRTCRTTCTG, nucleotides 9276 to 9257) or 9207 (TRCACTGGCT- GAACTGTT, nucleotides 9224 TO 9207) and PCR primers VEE130 (GAGAACTGCGAGCAATGGTCA, nucleotides 8369 to 8389) and VEE116 or 9207 to amplify a portion of