Isolation, genomic organization, and expression analysis of Men1, the
murine homolog of the MEN1 gene
Siradanahalli C. Guru,
1
Judy S. Crabtree,
1
Kevin D. Brown,
1
* Karen J. Dunn,
2
Pachiappan Manickam,
1
Nijaguna B. Prasad,
1
Danny Wangsa,
3
A. Lee Burns,
4
Allen M. Spiegel,
4
Stephen J. Marx,
4
William J. Pavan,
2
Francis S. Collins,
1
Settara C. Chandrasekharappa
1
1
Genetics and Molecular Biology Branch, National Human Genome Research Institute, National Institutes of Health, Building 49, Room 3E-13, 49
Convent Drive, Bethesda, Maryland, 20892-4442, USA
2
Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA
3
Genome Technology Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA
4
Metabolic Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health,
Bethesda, Maryland 20892, USA
Received: 17 December 1998 / Accepted: 2 February 1999
Abstract. The mouse homolog of the human MEN1 gene, which
is defective in a dominant familial cancer syndrome, multiple en-
docrine neoplasia type 1 (MEN1), has been identified and charac-
terized. The mouse Men1 transcript contains an open reading
frame encoding a protein of 611 amino acids which has 97%
identity and 98% similarity to human menin. Sequence of the
entire Men1 gene (9.3 kb) was assembled, revealing 10 exons, with
exon 1 being non-coding; a polymorphic tetranucleotide repeat
was located in the 5'- flanking region. The exon-intron organiza-
tion and the size of the coding exons 2–9 were well conserved
between the human and mouse genes. Fluorescence in situ hybrid-
ization localized the Men1 gene to mouse Chromosome (Chr) 19,
a region known to be syntenic to human Chr 11q13, the locus for
the MEN1 gene. Northern analysis indicated two messages—2.7
kb and 3.1 kb—expressed in all stages of the embryo analyzed and
in all eight adult tissues tested. The larger transcript differs from
the smaller by the inclusion of an unspliced intron 1. Whole-mount
in situ hybridization of 10.5-day and 11.5-day embryos showed
ubiquitous expression of Men1 RNA. Western analysis with anti-
bodies raised against a conserved C-terminal peptide identified an
approximately 67-kDa protein in the lysates of adult mouse brain,
kidney, liver, pancreas, and spleen tissues, consistent with the size
of human menin. The levels of mouse menin do not appear to
fluctuate during the cell cycle.
Introduction
Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dom-
inant familial cancer syndrome characterized by tumors of the
parathyroids, enteropancreatic endocrine tissues, and the anterior
pituitary (Metz et al. 1994). The MEN1 locus was mapped to
human Chr 11q13 by linkage analysis (Larsson et al. 1988), and
the responsible MEN1 gene was identified by positional cloning
(Chandrasekharappa et al. 1997). The human MEN1 gene is or-
ganized into 10 exons (the first being untranslated) and is ubiqui-
tously expressed as a 2.8-kb transcript. This transcript encodes a
610-amino acid product, termed menin, which exhibits no apparent
similarities to any known proteins. Over 200 independent germline
and somatic mutations spread throughout the coding region of
menin have been described (Marx et al. 1999). Somatic mutations
are observed to a variable extent in certain sporadic tumors: para-
thyroid adenoma, gastrinoma, insulinoma, and lung carcinoid
(Marx et al. 1999). MEN1 appears to be a typical tumor suppressor
gene: lack of menin owing to inactivation of both alleles probably
leads to the development of tumors.
Although no murine syndrome similar to MEN1 has been re-
ported to date, here we detail the identification of the mouse
MEN1 homologous gene, Men1, on mouse Chr 19. The cDNA
sequence, genomic organization, RNA and protein expression pat-
terns are presented and discussed.
Materials and methods
Screening BAC library. The entire Men1 cDNA sequence was as-
sembled by sequencing the insert in a cDNA clone (IMAGE clone ID
557658). DNA pools from a BAC library prepared from 129Sv/cJ7 mouse
DNA (Research Genetics, Huntsville, AL) were screened by PCR with
primers (5 ' -GCTGAAGGCGCCCAGAAGACG-3 ' and 5 ' -
CTGAGCGGTGAATCGGGCATAGAG-3') designed from the mouse
Men1 cDNA sequence. Three BAC clones, 331J21, 331K21, and 7D23,
were isolated. The size of the inserts was determined by pulsed-field gel
electrophoresis of NotI-digested BAC DNAs as described earlier (Guru et
al. 1997b).
Subcloning and sequence analysis. DNA isolated from the BAC clone
7D23 was subjected to partial digestion with Sau3A1 to generate fragments
of approx. 10–12 kb. The fragments were cloned into the BamH1 site of the
plasmid pBluescriptII KS+ (pBSIIKS+). Colonies were analyzed by PCR
with STSs designed for both the 5'- and 3'-ends of the Men1 cDNA in
order to identify the clones containing the entire gene. One clone with an
approximate 10-kb insert containing the entire Men1 gene was chosen for
subsequent sequence analysis and genomic characterization.
Primers, UP1 (GACATCCATGGCTACACAGAAAAACCC) and LP1
(GCCTGTGTAAAGGGAAGAAGACAGAGAGAGT), generating a 260-
bp product, were used for the PCR amplification of the (AAAG)
10
repeat
alleles from mouse genomic DNA.
Northern analysis. A 900-bp insert representing the 3'-end of the Men1
cDNA clone (IMAGE clone ID. 402210) was released by digestion of the
plasmid DNA with EcoRI and NotI, labeled with a random primer labeling
kit (Amersham) and hybridized to a mouse multiple tissue Northern blot
(#7762-1) and embryo blot (#7763-1) (Clontech, Palo Alto, CA) as de-
scribed earlier (Guru et al. 1997a). For the 5'-end probe, a 299-bp PCR
product representing most of intron 1 was amplified from the BAC clone
331J21.
* Present address: Dept. of Biochemistry and Molecular Biology, LSU
Medical Center, New Orleans, Louisiana 70112, USA.
Correspondence to: S.C. Chandrasekharappa
Mammalian Genome 10, 592–596 (1999).
© Springer-Verlag New York Inc. 1999
Incorporating Mouse Genome