Expression of adenosine A2a receptors gene in the olfactory bulb and spinal cord of rat and mouse Alain Kaelin-Lang*, Theres Lauterburg, Jean-Marc Burgunder Laboratory of Neuromorphology, Department of Neurology, Inselspital, University Hospital, CH-3010 Bern, Switzerland Received 28 December 1998; accepted 30 December 1998 Abstract The expression of adenosine A2a receptors (A2aR) in the mammalian striatum is well known. In contrast the exact distribution of A2aR in other regions of the central nervous system remains unclear. The aim of this study was to investigate the A2aR gene expression in the rat olfactory bulb and spinal cord, two regions which are seldom included in mapping studies. Secondly, we compared the A2aR expression in the rat and in the mouse brain. Hybridization histochemistry was performed with an S 35 - labelled radioactive oligonucleotide probe. The results show strong expression of A2aR in the mouse and rat striatum in accordance with previous reports. In the olfactory bulb a weak but specific expression of A2aR was found in the granular cell layer in both species. In contrast, no significant expression of the A2aR gene was observed in other parts of the brain or the rat spinal cord. The presence of the A2aR in the mammalian olfactory bulb suggests a functional role for this receptor in olfaction.  1999 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Purinergic receptors; A2a receptors; Mouse; Rat; Olfactory bulb; Spinal cord The neuromodulator adenosine acts through several membrane receptors. Four receptor-subtypes have been cloned: the A1, A2a, A2b and A3 receptors [6]. The pre- sence of A2a adenosine receptors (A2aR) is well established in the brain. A2aR have been identified in the striatum by binding studies [8] as well as by in situ hybridization his- tochemistry techniques [5] and A2aR have an important physiological function in the striatum [5]. However the exact distribution of A2aR in other parts of the central ner- vous system remains unclear. In the developing rat nervous system a widespread, partly transient distribution of A2aR has been found in several areas [17]. The presence of A2a receptors in the adult spinal cord and in the adult olfactory bulb has not yet been investigated. The aim of the present study was to investigate the expression of A2aR gene in these regions of the rat nervous system. Secondly the expression of A2aR in the rat brain was compared with the expression in the mouse brain. Adult female Wistar rats maintained on a 12:12 h light- dark cycle were used. One adult NMRI (National Maritime Research Institute) mouse maintained on a 10:14 h light- dark cycle was also used. Rats were killed by decapitation under carbon dioxide anesthesia. The mouse was killed by phenobarbital overdose. The brain with the olfactory bulb (n = 4) or the whole spinal (n = 7) cord were rapidly removed, frozen on dry ice or in nitrogen cooled isopentane and kept at -70°C until further processing. In situ hybridi- zation histochemistry was performed as described in [18]. Briefly, series of 12 mm adjacent sections were mounted onto gelatin-coated slides. After fixation with 4% formalde- hyde in phosphate buffered saline (PBS), the sections were washed twice in PBS. They were then placed in 0.25% acetic anhydride in 0.1 M triethanolamine/0.9% NaCl (pH 8), for 10 min and delipidated in ethanol and chloroform. The sections were treated with 0.5–1 × 10 6 dpm of the oli- gonucleotide probe. An oligonucleotide (48-mer: gacc- gagtccgctcccctggcaggggctggctctccatctgcttcagc) recogniz- ing the bases 891 to 938 of the A2a rat gene [2] was commercially synthesized (Microsynth Laboratories, Wind- isch, Switzerland). This probe has already been used for in situ histochemistry in the rat brain and characterized by Neuroscience Letters 261 (1999) 189–191 0304-3940/99/$ - see front matter  1999 Elsevier Science Ireland Ltd. All rights reserved. PII: S0304-3940(99)00022-1 * Corresponding author. Tel.: +41-31-6322111; fax: +41-31- 6329679; e-mail: alain.kaelin@dkf6.unibe.ch