Electronic Supplementary Information Drug delivery by a self-assembled DNA tetrahedron for overcoming drug resistance in breast cancer cells Kyoung-Ran Kim, a Da-Rae Kim, a Eungjin Ahn, c Ji Young Yhee, a Byeong-Su Kim, d Ick Chan Kwon a and Dae-Ro Ahn * a,b a Center for Theragnosis, Biomedical Research Institute, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136-791, Republic of Korea. Fax: +82 2 958 5909; Tel: +82 2 958 6645; E-mail: drahn@kist.re.kr b KIST campus, University of Science (UST-KIST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136- 791,Republic of Korea. c School of NanoBioscience and Chemical Engineering, Ulsan National Institute of Science and Engineering (UNIST), Ulsan 689-798, Republic of Korea. d Interdisciplinary School of Green Energy and KIER-UNIST Advanced Center for Energy, Ulsan National Institute of Science and Engineering (UNIST), Ulsan 689-798, Republic of Korea. Table S1. DNA oligonucleotides used to construct Td. DNA Sequence S1 5’CCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAATTTATCACCCG CCATAGTAGACGTATCA S2 5’CTTGCTACACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCC AATACCGACGATTACAG S3 5’GGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGC CCATCCACTACTATGGCG Cy5-S4 5’Cy5-CCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATG CTCTTCCCGACGGTATTGGAC FAM-S4 5’FAM-CCTCGCATGACTCAACTGCCTGGTGATACGAGGATG GGCATGCTCTTCCCGACGGTATTGGAC Electronic Supplementary Material (ESI) for Chemical Communications This journal is © The Royal Society of Chemistry 2013