Zilfalil et al. Int J Pharm Pharm Sci, Vol 6, Issue 11, 437-439 437 Original Article MOLECULAR ANALYSIS OF THE CAMP- RESPONSE ELEMENT [CRE] ELEMENTS IN THE PROMOTER REGION AND EXON 1 OF THE SURVIVAL OF MOTOR NEURON 2 [SMN2] GENE IN MALAYSIAN SPINAL MUSCULAR ATROPHY PATIENTS; TO ELUCIDATE THEIR ROLE IN CIRCUMSCRIBING THE CLINICAL SEVERITY OF SMA ATIF A. B. 1,5 , CHAN Y. Y. 2 , RAVICHANDRAN M. 3 , ZILFALIL B. A. 4 1 Faculty of Medicine and Health Sciences, Universiti Sultan Zainal Abidin, 2 Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, 16150 Kubang Kerian,Kelantan, Malaysia, 3 Department of Biotechnology, Faculty of applied sciences, AIMST University, Semeling, 08100 Bedong, Kedah, 4 Department of Pediatrics, School of Medical Sciences, University Sains Malaysia 16150 Kubang Kerian, Kota Bharu, Kelantan, Malaysia, 5 Human Genome Center, University Sains Malaysia 16150 Kubang Kerian, Kota Bharu, Kelantan, Malaysia. Email: zilfalil2@hotmail.com Received: 24 Sep 2014 Revised and Accepted: 26 Oct 2014 ABSTRACT Objective: In the Spinal muscular atrophy [SMA] genes [SMN1 and SMN2 genes]; the CRE-II elements at -400 bp in the promoter region of the SMN genes and CRE-I element at +108 bp in the exon 1 of the SMN genes, are reported to have a role in c-AMP induce expression of the SMN genes through its binding affinity to CREB-1. This study was designed to determine the role of CRE sites in the circumscribing the clinical severity of SMA. Methods: Direct sequencing was performed for the PCR products of the promoter regions of the SMA patients with homozygous deletion of SMN1, different copy number of SMN2 and NAIP non deletion. Results: No variation among the CRE-I and CRE-II sites was found in all the clinical types as compare to normal healthy control showing no role of CRE sites in circumscribing the clinical severity of SMA. Conclusion: There was no sequence variation found in the CRE binding sites in the three different clinical types of SMA reflecting no role of CRE binding sites in circumscribing the clinical severity of SMA. Keywords: SMA, CRE-II, CREB, Promoter of SMN gene. INTRODUCTION In some patients of Spinal Muscular Atrophy [SMA] with homozygous deletion of the SMN1 gene and 2 copies of SMN2 gene, the differences in the severity of SMA suggests that the production of the FL-SMN protein may be different in different clinical types even with the same number [2 copies] of the SMN2 gene [1]. Increased expression of the SMN genes through froskolin or BT2 which act through CRE sites in all clinical severities [2] of SMA reflects these compounds must have no effect if CRE binding site is mutated. This study aimed to analyze the variation in the CRE binding sites of the normal healthy individuals and patients of SMA from different clinical types. The study could be very significant in defining the difference in transcriptional control, variation among promoter of healthy compared to promoter of SMA patients and also variations among the promoter of SMN2 gene among SMA patients from different clinical types with CRE-I site at +108 bp and CRE-II element in at -400 bp upstream in the reported sequence for the promoter region of the SMN2 gene [3]. MATERIALS AND METHODS Patients’ recruitment A total of 134 patients were included in this study by applying single proportion formula [n > [z α / Δ] 2 DNA extraction and SMA genes analysis x P [1-P]], where n [96] is the minimum sample required, z α was set at 1.96 for allowing Type I error for 5% [0.05], Δ [0.1] is the estimation of having mutation in SMN2 promoter region and P [0.5] is the proportion of having mutation in SMN2 promoter region. The diagnosis was based on the clinical criteria as setup by the 59th and 93rd ENMC International Workshop on SMA in 1998 and 2001 respectively [4, 5]. The clinically summary of all the patients was reviewed at Hospital Universiti Sains Malaysia [HUSM] by the pediatric neurologist and 58 patients were excluded from the study as the criteria of SMA international consortium were not fulfilled by them. This study was conducted with the permission of USM ethical clearance and was funded by the grant from ministry [SAGA grant]. The samples of remaining 69 patients were received from different hospitals all over Malaysia. Informed consent was obtained prior to blood taking. Total of 69 normal healthy individuals were used as a negative control. DNA was extracted from whole blood using a DNA extraction kit, GeneAll® ExgeneTM Blood SV [GeneAll Biotechnology Co. Ltd., Korea]. The DNA was quantified using Eppendrof DNA spectrophotometer. The 42 patients with homozygous SMN1 deletion were analyzed for the copy number analysis of the SMN2 gene and NAIP deletion [6,7]. This part of the analysis has been reported previously by our group [8]. Molecular analysis of the CRE sites A total of 10 patients were selected for further analysis. All these patients were checked for the presence of the NAIP gene to remove any clinical bias in the methodology and disease severity. Firstly, we included only the patients with 2 copies of the SMN2 gene. Later, nucleotide variation analysis was also performed on patients with 3 and 4 copies of the SMN2 gene in different clinical types considering the previous report stating that the patients with more than 2 copies of SMN2 and different clinical severity shows same levels of FL-SMN [1]. As previously reported [2], the CRE-II element was analyzed for the molecular variation in normal healthy individuals and SMA patients from different clinical types. The primers were designed manually using the SMN2 promoter sequence Gen Bank entry [GenBank accession number; AF187725]. Two primers were designed, forward P3932 [5’TGAGCTCAGGAGTTCGAGAC3’] and complementary reverse PCR [5’GGCGTGTATATTTTTCATTTCTC3’] for analyzing CRE-I site and for CRE-II we made use of primers for International Journal of Pharmacy and Pharmaceutical Sciences ISSN- 0975-1491 Vol 6, Issue 11, 2014 Innovare Academic Sciences