Elevated Alpha Synuclein mRNA Levels Are Associated with Craving in Patients with Alcoholism Dominikus Bönsch, Udo Reulbach, Kristina Bayerlein, Thomas Hillemacher, Johannes Kornhuber, and Stefan Bleich Background: Alpha synuclein has been found elevated in dopamine neurons of cocaine abusers and in rats whose alcohol preference is inbred. Methods: The alpha synuclein mRNA expression level was measured by quantitative polymerase chain reaction in the blood of 75 male alcoholics and 69 nondrinking healthy control subjects. Alcohol craving was assessed by the Obsessive-Compulsive Drinking Scale total score, including subscales for obsessive and compulsive craving. Results: The alpha synuclein expression in patients with alcoholism (2.79 CT; SD  1.69; p  .021) was significantly higher when compared with healthy control subjects (2.20 CT; SD  1.59). Increased alpha synuclein levels significantly predict Obsessive- Compulsive Drinking Scale total score (odds ratio  1.44, 95% confidence interval: 1.01–2.06, p  .042) and especially Obsessive-Compulsive Drinking Scale obsessive subscale (odds ratio  1.74, 95% confidence interval: 1.18 –2.58, p  .005) but not Obsessive-Compulsive Drinking Scale compulsive subscale alcohol craving. Conclusions: Higher levels of alpha synuclein are associated with an increase in alcohol craving. The present results provide a novel pathophysiological approach to the explanation of craving mechanisms. Key Words: Alcoholism, alpha synuclein, mRNA, craving, dopami- nergic neurotransmission A lpha synuclein is involved in dopaminergic neurotrans- mission (Perez et al 2002). It regulates synaptic dopamine homeostasis (Lotharius et al 2002) and influences the expression of dopamine synthesis genes such as GTP cyclohy- drolase, tyrosine hydroxylase (TH), and aromatic acid decarbox- ylase (Baptista et al 2003). Dopaminergic transmission has been suggested to be a main mechanism mediating reinforcement, withdrawal, and craving associated with alcohol addiction (Self et al 1995). Most recently, evidence has been presented that alpha-synuclein levels are elevated in midbrain dopamine neu- rons of chronic cocaine abusers (Mash et al 2003). Furthermore, an increased expression of alpha synuclein in different brain areas may contribute to alcohol preference in rats whose alcohol preference is inbred (Liang et al 2003). Therefore, the aim of this study was to investigate whether the expression of alpha synuclein in the blood of patients with alcoholism undergoing alcohol withdrawal is altered. The hy- pothesis was that higher levels of alpha synuclein are associated with increased alcohol craving. Methods and Materials The present prospective case control study was approved by the Institutional Review Board of the University of Erlangen- Nuremberg. All southern German subjects from the Franconian Alcoholism Research Studies (FARS) were informed and signed an informed consent form before participating in any part of the study. To compare the groups as accurately as possible, Cauca- sian control subjects were matched to Caucasian cases by age at which males were included, only because of the relatively small sample size (n  4) of females. In total, the study included 75 male patients with alcoholism (mean age  42.9, SD  8.9; range  23– 65) and 69 nondrinking male healthy control subjects (mean age  41.8, SD  19.2; range  20 –72) who had no disorder meeting DSM-IV criteria. The alcohol consumption of control subjects did not exceed 30 g ethanol intake per week. All patients were active drinkers or had abstained from alcohol between 24 and 72 hours. Patients had a history of alcohol consumption ranging from 7 to 42 years (mean  18.9 years, SD  10.0). The patients were taking no drugs before being included in the study. Patients with any other concomitant psychiatric illness were excluded from the study. Furthermore, patients with any commonly known risk factors affecting alpha synuclein were not enrolled. Fasting blood samples for RNA extraction were drawn on admission in ethylenediaminetetraacetic (EDTA) acid-containing tubes and were stored at 80°C immediately after collection. Total RNA was extracted from whole frozen EDTA blood using a modified Qiagen protocol: A phenol extraction in Qiazol (Qia- gen, Hilden, Germany) was followed by column purification with RNeasy Mini Kit (Qiagen), including DNase digestion. Reverse transcription was done by using poly-dT primers and AMV Reverse Transcriptase from the Roche cDNA Synthesis System (Roche, Palo Alto, California). Quantitative polymerase chain reaction (PCR) was performed using SYBR Green I Master Mix buffer (Applied Biosystems, Foster City, California), and reactions were run on an iCycler (Bio-Rad Laboratories, Her- cules, California) using a three-step standard protocol with an annealing temperature of 66°C. Glyseraldehyde-3-phosphate de- hydrogenase (GAPDH) was used as internal standard, and CT values were calculated from differences between GAPDH and alpha synuclein. All experiments were repeated three times. We used the following primer pairs: GAPDH-F (CACCAGGGCT- GCTTTTAACTCTGGTA), and GAPDH-R (CCTTGACGGTGC- CATGGAATTTGC); A-Syn-F (GCCAAGGAGGG-AGTTGTG- GCTGC), and A-Syn-R (CTGTTGCCACACCATGCACCACTCC). We assessed the Obsessive-Compulsive Drinking Scale (OCDS) total score (OCDS-ts), the obsessive subscale (OCDS- os), and the compulsive subscale (OCDS-cs) on the day of From the Department of Psychiatry and Psychotherapy, Friedrich-Alex- ander-University of Erlangen-Nuremberg, Erlangen, Germany. Address reprint requests to Dominikus Bönsch, M.D., Friedrich-Alexander- University of Erlangen-Nuremberg, Department of Psychiatry and Psy- chotherapy, 91054 Erlangen, Germany; E-mail: dominikus.boensch@ psych.imed.uni-erlangen.de. Received June 1, 2004; revised September 14, 2004; accepted September 24, 2004. BIOL PSYCHIATRY 2004;56:984 –986 0006-3223/04/$30.00 doi:10.1016/j.biopsych.2004.09.016 © 2004 Society of Biological Psychiatry