Identification of tumor suppressive microRNAs in maxillary sinus squamous cell carcinoma based on microRNA expression signature Abstract #121 Toyoyuki Hanazawa 1 , Nijiro Nohata 1,2 , Naoko Kikkawa 1 , Muradil Mutallip 1 , Akihiro Katayama 3 , Yasuaki Harabuchi 3 , Yoshitaka Okamoto 1 and Naohiko Seki 2 1 Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan 2 Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan 3 Department of Otorhinolaryngology / Head and Neck Surgery, Asahikawa Medical University, Asahikawa, Japan Nature Medicine 11,712-714. 2005 MicroRNAs (miRNAs) are an abundant class of small non-protein-coding RNAs that function as negative gene regulators. They regulate diverse biological processes, and bioinformatic data indicates that each miRNA can control hundreds of gene targets, underscoring the potential influence of miRNAs on almost every genetic pathway. Recent evidence has shown that miRNA mutations or mis-expression correlate with various human cancers and indicates that miRNAs can function as tumour suppressors and oncogenes. miRNAs have been shown to repress the expression of important cancer-related genes and might prove useful in the diagnosis and treatment of cancer. Role of microRNAs in Cancer Maxillary sinus squamous cell carcinoma (MSSCC) comprises 2-3% of all cancers of head and neck tumor and the annual incidence rate is 0.5-1.0 per 100,000 populations. Clinical symptoms of MSSCC present insidiously. Primary tumors are often diagnosed as advanced disease. The 5-years survival rate of T4 tumors is 50% around. Local recurrence is the most common cause of treatment failure and death . There is no genome-wide gene expression analysis of MSSCC so far. There is no analysis of microRNA (miRNA) for this disease at all. Maxillary sinus squamous cell carcinoma Aims of this study 1. To identify the down-regulated miRNAs based on miRNA expression signature using MSSCC clinical specimens. 2. To elucidate the tumor suppressive miRNAs among the down-regulated miRNAs by performing gain-of- function assay. 3. To find candidate target gene of tumor suppressive miRNA by performing genome- wide analysis (microarray analysis and web-based program search). Key findings 1. Several tumor suppressive miRNAs were identified from the down-regulated miRNAs based on miRNA expression signature of MSSCC clinical specimens. 2. miR-874, miR-1 and miR-133a inhibited cell proliferation and induced cell apoptosis in IMC-3. 3. Genome-wide expression analysis using miR-1/miR-133a transfectants revealed that TAGLN2 was regulated by miR-1/miR-133a. 4. Knockdown of TAGLN2 by siRNA inhibited cell proliferation in IMC-3 and TAGLN2 was up-regulated in clinical MSSCC tissues 1. Characteristics of twenty patients with MSSCC miRNA Accession No. Chromosome Locus Fold change Normalized ratio P-Value Normal Tumor miR-874 MIMAT0004911 5q31.2 0.011 3.05E-04 3.36E-06 0.0463 miR-133a MIMAT0000427 18q11.2, 20q13.33 0.017 1.89E-02 3.14E-04 0.0033 miR-375 MIMAT0000728 2q35 0.035 3.95E-02 1.36E-03 0.0161 miR-204 MIMAT0000265 9q21.12 0.045 3.26E-02 1.47E-03 0.0055 miR-1 MIMAT0000416 18q11.2, 20q13.33 0.054 1.88E-03 1.02E-04 0.0240 No. Age Gender Differentiation T N M Stage 1 68 Male Well 4b 0 0 IVB 2 77 Male Poor 3 0 0 III 3 76 Male Moderate 3 0 0 III 4 61 Male Well 3 0 0 III 5 54 Male Poor 3 0 0 III 6 65 Female Poor 4b 0 0 IVB 7 65 Male Moderate 4a 0 0 IVA 8 64 Male Poor 4b 0 0 IVB 9 74 Male Well 4a 0 0 IVA 10 71 Male Moderate 3 1 0 III 2. Top five down-regulated miRNAs from TaqMan LDA 3. Validation of miRNAs expression in 20 clinical specimens by qRT-PCR Entrez Gene ID Gene name Symbol Log2 ratio miR-1 target site miR- 133a target site miR- 1 miR- 133a Average 8407 transgelin 2 TAGLN2 - 2.78 -1.98 -2.38 3 2 5819 poliovirus receptor-related 2 (herpesvirus entry mediator B) PVRL2 -2.7 -1.9 -2.3 - - 201895 chromosome 4 open reading frame 34 C4orf34 - 3.01 -1.51 -2.26 2 1 83473 katanin p60 subunit A-like 2 KATNAL2 - 2.65 -1.69 -2.17 - - 1081 glycoprotein hormones, alpha polypeptide CGA - 2.38 -1.92 -2.15 - - 255758 Tctex1 domain containing 2 TCTEX1D2 - 2.12 -2.14 -2.13 - - 100130691 hypothetical LOC100130691 hCG_1817306 - 1.79 -2.22 -2 - - 56062 kelch-like 4 (Drosophila) KLHL4 - 1.83 -2.08 -1.96 - - 2200 fibrillin 1 FBN1 - 1.78 -1.98 -1.88 - - 7837 peroxidasin homolog (Drosophila) PXDN - 1.74 -1.99 -1.87 1 2 6. Down-regulated genes in miR-1/miR-133a transfected IMC-3 Control miRNA miR-1 miR-133a 5. Microarray Analysis with tumor suppressive miRNAs Conclusions Tumor suppressive miRNAs and target oncogenes molecular network may provide new insight into understanding of the potential mechanisms in cancer. Our findings have therapeutic implications and may be exploited for future treatment of MSSCC. AACR 102 nd ANNUAL MEETING, Sunday April 3, 2011, 1:00 PM – 5:00 PM Normal Tumor P = 0.0307 0 0.020 0.015 0.010 0.005 miR-874 expression (Normalized to RNU48) miR-1 expression (Normalized to RNU48) 0.005 0.010 0.015 0.020 0.025 0.030 0.035 0 P = 0.0023 Normal Tumor 0.005 0.010 0.015 0.020 0.025 0.030 0.035 0 0.040 P = 0.0382 miR-133a expression (Normalized to RNU48) Normal Tumor 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 Normal Tumor miR-375 expression (Normalized to RNU48) P = 0.0006 0 0.05 0.10 0.15 0.20 0.25 0.30 Normal Tumor P = 0.0069 miR-204 expression (Normalized to RNU48) 4. miR-874, miR-1 and miR-133a inhibit cell proliferation and induce apoptosis in IMC-3 (IMC-3 was established from a tumor of a patient with maxillary cancer. ) 0 0.5 1.0 1.5 2.0 2.5 3.0 control miR-874 Early apoptosis cells (% of control) * 0 1 2 3 4 5 6 control miR-1 * miR-133a * miR-1 expression 0 0.02 0.04 0 0.025 0.125 miR-133a expression 0.050 0.075 0.100 r = 0.571 P < 0.001 0.5 0 1.0 1.5 2.0 2.5 3.0 3.5 4.0 P = 0.0321 Normal Tumor TAGLN2 expression (Normalized to GUSB) TAGLN2 mRNA expression (relative to mock) 0 20 Mock Control * 40 60 80 100 120 * miR-1 miR-133a 7. TAGLN2 mRNA and protein expression were regulated by miR-1/miR-133a in IMC-3 * P < 0.05 * P < 0.05 * P < 0.05 Positive correlation between miR-1 and miR-133a TAGLN2 β-actin No. Age Gender Differentiation T N M Stage 11 64 Male Moderate 4a 0 0 IVA 12 80 Male Moderate 4a 0 0 IVA 13 66 Female Poor 4a 2c 0 IVA 14 67 Male Moderate 4a 0 0 IVA 15 60 Male Poor 4a 0 0 IVA 16 66 Female Moderate 4a 0 0 IVA 17 85 Male Poor 4a 0 0 IVA 18 69 Male Well 4a 0 0 IVA 19 57 Male Poor 4a 0 0 IVA 20 69 Male Poor 4a 2b 0 IVA 0 20 40 60 80 100 120 Proliferation (% of control) * * * Cell proliferation (% of mock) 0 20 * 40 60 80 100 120 TAGLN2 (NM_003564) 3’UTR length:686 0.2k 0.4k 0.6k miR-133a target sites 5' ...AUAGCCAUCAAAACUGGACCAAC. .. ||||||| 3' GUCGACCAACUUCCCCUGGUUU 5' ...UCUUCCUUUCCCCUGGGACCAAA. .. ||||||| 3' GUCGACCAACUUCCCCUGGUUU 214-220 242-248 8. Silencing TAGLN2 inhibit cell proliferation and TAGLN2 was up-regulated in clinical MSSCC tissues miR-1 target sites 5' ...UAUAUUUUAGCAGUGACAUUCCC ||||||| 3' UAUGUAUGAAGAAAUGUAAGGU 71-77 185-191 348-354 5' ...CCCAUGCUUACUAAU--ACAUUCCC |||| ||||||| 3' UAUGUAUGAAGAAAUGUAAGGU 5' ...UCUGUGUCCUCCGUUCAUUCCAU |||||| 3' UAUGUAUGAAGAAAUGUAAGGU IMC-3