Journal of General Virology (2001), 82, 2647–2652. Printed in Great Britain .......................................................................................................................................................................................................... SHORT COMMUNICATION Genetic variability of hepatitis A virus in South America reveals heterogeneity and co-circulation during epidemic outbreaks Mauro Costa-Mattioli, 1,2 Virginie Ferre, 1 Serge Monpoeho, 1 Laura Garcia, 2 Rodney Colina, 2, 3 Sylviane Billaudel, 1 Ines Vega, 4 Raul Perez-Bercoff 5 and Juan Cristina 2 1 Laboratorie de Virologie, Institut de Biologie, Centre Hospitalier Regional Universitaire de Nantes, Rue Quai Moncousu 9, 44093 Nantes, France 2 Departamento de Te cnicas Nucleares Aplicadas, Centro de Investigaciones Nucleares, Facultad de Ciencias, Universidad de la Repu blica, Igua 4225, 11400 Montevideo, Uruguay 3 Laboratorio de Biologı a Molecular, Asociacio n Espan ola Primera de Socorros Mutuos, Boulevard Artigas 1465, 11200 Montevideo, Uruguay 4 Instituto de Hematologia, Facultad de Medicina, Universidad Austral de Chile, Casilla 567, Valdivia, Chile 5 Department of Cellular and Developmental Biology, University of Rome La Sapienza, Viale di Porta Tiburtina 28, 00185 Roma, Italy Genetic analysis of selected genome regions of hepatitis A virus (HAV) suggested that distinct genotypes of HAV could be found in different geographical regions. In order to gain insight into the genetic variability and mode of evolution of HAV in South America, an analysis was performed of sequence data obtained from the VP1 amino ter- minus and the VP1/2A region of HAV strains isolated over a short period of time in Uruguay, Argentina and Chile. Sequences obtained from 22 distinct HAV isolates were compared with published sequences from 21 different strains isolated all over the world. Phylogenetic analysis revealed that all strains isolated belong to a unique sub-genotype (IA). Strains isolated during an outbreak period showed a higher degree of heterogeneity than anticipated previously and the co-circulation of different isolates. The genetic variability among strains isolated in this region seems to be higher in comparison with strains isolated in other regions of the world. Human hepatitis A virus (HAV) is a hepatotropic member of the family Picornaviridae (Melnick, 1982 ; Matthews, 1982). Despite its overall physical and epidemiological similarity to enteroviruses, the structural composition of HAV, its tissue Author for correspondence : Juan Cristina. Fax 598 2 525 08 95. e-mail cristinacin1.cin.edu.uy The EMBL accession numbers of the sequences reported in this work are AJ406305–AJ406323, AJ306367–AJ306387 and AJ309219–AJ309234. tropism and genetic distance from other members of the family indicate that HAV is unique within this family (Ticehurst et al., 1988 ; Palmenberg, 1989 ; Wimmer & Murdin, 1991). Early comparative studies of the nucleotide sequences of different HAV strains suggested that isolates of diverse origin were closely related (Ticehurst et al., 1989). However, more recent nucleotide sequencing of variable genome regions, encoding the VP1 amino terminus and the putative VP12A junction of wild-type HAV strains present in human specimens from different regions of the world, has demonstrated substantial sequence heterogeneity (Robertson et al., 1991, 1992 ; Taylor, 1997). These studies have suggested that sequence relatedness can be correlated with the geographical area of virus isolation (Robertson et al., 1991). Using this approach, seven distinct genotypes of HAV have been defined worldwide (Robertson et al., 1992). In order to study the genetic variation of HAV strains circulating in South America, 10 IgM anti-HAV- positive serum samples from patients were collected at Pereira Rossell Hospital and Asociacio n Espan ola Primera de Socorros Mutuos Hospital during an epidemic outbreak that occurred in Montevideo (Uruguay) from September 1999 to February 2000. Over the same period of time, eight stool samples from Chilean patients were collected at Hospital Regional in Valdivia and four stool samples from Argentinian patients were collected at Hospital San Juan de Dios in Buenos Aires. For diagnostic screening of HAV, we used a real time RT–PCR assay based on a conserved region of the 5non-coding region. The primers sequences were as follows : forward primer HAV1 (5TTTCCGGAGCCCCTCTTG 3), reverse primers HAV2 (5AAAGGGAAATTTAGCCTATAGCC 3) and HAV3 (5AAAGGG AAAATTTAGCCTATAGCC 3) and HAV-probe (5FAM–ACTTGATACCTCACCGCCGTTTG- CCT–TAMRA 3; FAM, 6-carboxyfluorescein ; TAMRA, 6- carboxy-N,N,N,N-tetramethylrhodamine). 0001-7817 2001 SGM CGEH