Molecular & Biochemical Parasitology 195 (2014) 10–13 Contents lists available at ScienceDirect Molecular & Biochemical Parasitology Short communication Gene disruption reveals a dispensable role for Plasmepsin VII in the Plasmodium berghei life cycle Babu S. Mastan a , Anchala Kumari b , Dinesh Gupta b , Satish Mishra c , Kota Arun Kumar a,∗ a Department of Animal Sciences, School of Life Sciences, University of Hyderabad, Hyderabad, India b Bioinformatics Laboratory, SCB Group, International Centre for Genetic Engineering and Biotechnology, Aruna Asaf Ali Marg, 110 067 New Delhi, India c Division of Parasitology, CSIR-Central Drug Research Institute, Lucknow, India a r t i c l e i n f o Article history: Received 24 February 2014 Received in revised form 14 May 2014 Accepted 22 May 2014 Available online 2 June 2014 Keywords: Plasmodium Mosquito stages Plasmepsins Aspartic proteases a b s t r a c t Plasmepsins (PM), aspartic proteases of Plasmodium, comprises a family of ten proteins that perform criti- cal functions in Plasmodium life cycle. Except VII and VIII, functions of the remaining plasmepsin members have been well characterized. Here, we have generated a mutant parasite lacking PM VII in Plasmodium berghei using reverse genetics approach. Systematic comparison of growth kinetics and infection in both mosquito and vertebrate host revealed that PM VII depleted mutants exhibited no defects in development and progressed normally throughout the parasite life cycle. These studies suggest a dispensable role for PM VII in Plasmodium berghei life cycle. © 2014 Elsevier B.V. All rights reserved. Plasmepsins are aspartic proteases of Plasmodium falciparum (P. falciparum) that have been extensively studied in blood stages for their role in hemoglobin (Hb) degradation and hence as potential drug targets. P. falciparum encodes for ten plasmepsins [1], out of which four paralogues viz., PM I, II, III (HAP) and IV have been shown to reside in the acidic food vacuole of P. falciparum infected red blood cells. These plasmepsins orchestrate an ordered process of Hb degradation where PM I and PM II likely catalyze the initial cleavage. Further catabolism of Hb to free amino acids is facilitated by combined action of histoaspartic protease (HAP, PM III), PM IV, cysteine proteases and metalloproteases [2]. Though PM V, IX and X are expressed in the blood stages, they do not have a function in the food vacuole [3]. PM V is a parasite endoplasmic reticulum resident protease [4] that cleaves the export cargo containing PEXEL motif to facilitate their translocation into cytosol to promote virulence and erythrocyte take over [5,6]. Both PM IX and X were shown to localize in trophozoite stage [3]. While PM IX locus is recalcitrant to gene disruption reiterating its essential role in blood stages [7], the function of PM X is not known. PM VI, VII and VIII are not expressed in the blood stages [3,8] implying a possible role in other stages. An evidence corroborating ∗ Corresponding author at: Department of Animal Sciences, School of Life Sciences, University of Hyderabad, Hyderabad 500 046, India. Tel.: +91 040 23134530. E-mail addresses: kaksl@uohyd.ernet.in, kumar arun03@yahoo.com (K.A. Kumar). for an extra erythrocytic function of PM VI was recently reported in mosquitoes stages of Plasmodium berghei (P. berghei), where deple- tion of pm vi led to absence of salivary gland sporozoites, though functional oocyst were observed [7]. While gene expression data for PM VII in mosquito transmission stages have been reported earlier [9,10] its functional role has not been investigated. A better under- standing of its role in other Plasmodium stages may provide novel insights into their biological roles unique to these stages. Towards this end, we have undertaken a genetic approach to investigate the role of P. berghei PM VII (PBANKA 051760) in the parasite life cycle. We first analyzed the gene expression of PM VII both in the mosquito and liver stages by quantitative real time PCR. The cDNA samples were prepared at different time points from both mosquito and liver stages as described in supplementary material. Normalized data obtained as a ratio of P. berghei PM VII/P. berghei 18S rRNA revealed highest level of transcript abundance on day 4 (MSD4) post blood meal. While other time points of mosquito stages showed modest expression, no expression was detected in the liver stages (Fig. 1A). In order to reveal the function of the PM VII, we have generated a loss of function mutant using gene replace- ment strategy (Fig. 1B). To achieve this, we amplified 650 bp of 5 ′ and 550 bp of 3 ′ sequence flanking the target (PBANKA 051760) by PCR. The primer pair CTCGAG GGAGCAATTATGTTACTATATC and ATCGAT GGTTTATACACTTGTACGACA were used to amplify the 5 ′ end and the primer pair GCGGCCGC CCTGAATGGAAAAGAATACATA and GGCGCGCC CCACTATTTAACCACACGATT were used to amplify the 3 ′ end. The restriction sites in the sequence are underlined. http://dx.doi.org/10.1016/j.molbiopara.2014.05.004 0166-6851/© 2014 Elsevier B.V. All rights reserved.