Seminar Nasional Teknologi Peternakan dan Veteriner 2011 59 ANALISIS KERAGAMAN GENETIK KERBAU LOKAL (Bubalus bubalis) BERDASARKAN HAPLOTIPE DNA MITOKONDRIA (Analysis of Genetic Diversity of Local Buffaloes (Bubalus bubalis) Based on Mitochondrial DNA Haplotypes) WIWIN TARWINANGSIH 1 , A. FARAJALLAH, 2 C. SUMANTRI 1 dan E. ANDREAS 1 1 Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan, Institut Pertanian Bogor 2 Departemen Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam IPB, Institut Pertanian Bogor ABSTRACT Mitochondrial DNA analysis is often used to study genetic diversity and phylogenetic relationships of the population through maternal inheritance pattern. This study aimed to identify the genetic variation among local buffaloes based on mtDNA. A total of 44 blood samples were collected from four provinces respectively, namely Central Java (10 heads), Nusa West-East (12 heads), North Sumatra (10 heads) and Banten (12 heads). MtDNA genome was extracted using phenol-chloroform protocol and amplified by polymerase chain reaction (PCR) and cut with restriction enzymes(restriction fragment length polymorphisms/RFLP). Primers used in the Forward GCATACGCAATCTTACGATCA (AF22) and Revers GTAGCTGGACTTAACTGCAT (AF23). PCR products along the 1145 base pairs (bp) was cuted with four restriction enzymes, namely AluI HaeIII, HinfI and MspI. The results showed the existence of two mtDNA haplotypes. The first haplotype had a widespread distribution throughout the sampling area, whereas the second haplotype was only found in one sample of North Sumatra. Based on the presence or absence of the restriction sites of the two haplotypes, it was obtained the value of nucleotide diversity (π) of 0.17%. The calculation of genetic distance in the form of a dendrogram showed that the samples of buffalo which coming from Central Java, Nusa West-East and Banten were probably derived from a common ancestor (D = 0.0000). Similarly, samples of buffaloes from North Sumatra was closely related to the third area (D = 0.0061). Key Words: MtDNA Genes, Buffalo, Bubalus Bubalis, PCR-RFLP ABSTRAK Analisis DNA mitokondria sering digunakan untuk mempelajari keragaman genetik populasi dan hubungan filogenetik melalui pola pewarisan maternal. Penelitian ini bertujuan untuk untuk mengidentifikasi keragaman gen cyt-b hingga daerah pengendali (d-loop) genom mitokondria kerbau lokal (Bubalus bubalis), Sebanyak 44 sampel darah dikoleksi dari empat provinsi yaitu masing-masing Jawa Tengah (10 ekor), Nusa Tenggara Barat (12 ekor), Sumatera Utara (10 ekor) dan Banten (12 ekor). Genom mtDNA diekstrak menggunakan phenol-chloroform protocol dan diamplifikasi dengan teknik polymerase chain reaction (PCR), dan primer forward yang digunakan GCATACGCAATCTTACGATCA (AF22) dan Revers GTAGCTGGACTTAACTGCAT (AF23). Produk PCR sepanjang 1145 pasang basa (pb) dipotong dengan enzim restriksi AluI, HaeIII, HinfI dan MspI (restriction fragment length polymorphisms/RFLP). Hasil penelitian menunjukkan adanya dua haplotipe mtDNA. Haplotipe pertama memiliki pola penyebaran luas di seluruh wilayah pengambilan sampel, sedangkan haplotipe kedua hanya ditemukan pada satu sampel dari wilayah Sumatera Utara. Berdasarkan ada tidaknya situs restriksi dari dua haplotipe, diperoleh nilai keragaman nukleotida (π) sebesar 0,17%. Perhitungan jarak genetik dalam bentuk dendrogram menunjukkan bahwa sampel kerbau yang berasal dari Jawa Tengah, Nusa Tenggara Barat dan Banten diduga berasal dari nenek moyang yang sama (D = 0,0000). Begitu pula dengan sampel kerbau dari Sumatera Utara berkerabat dekat dengan ketiga wilayah tersebut (D = 0,0061). Kata Kunci: Gen MtDNA, Kerbau, Bubalus Bubalis, PCR-RFLP