International Journal of Scientific and Research Publications, Volume 4, Issue 4, April 2014 1 ISSN 2250-3153 www.ijsrp.org Heterotrophic denitrification by Gram-positive bacteria: Bacillus cereus and Bacillus tequilensis Moukhlissi Saïd * , Aboussabiq Fatima Ezzahra * , Amine Jamal * , Rihani Mohammed * and Assobhei Omar * * Laboratory of Marine Biotechnology and Environment, Faculty of Science of El Jadida, P.O. Box 20, El Jadida 24000, Morocco. Abstract- Two bacteria were isolated from anoxic denitrifying reactor for treatment of domestic wastewater. The analysis of the 16S rDNA gene sequences showed that the isolated strains were affiliated with Bacillus cereus and Bacillus tequilensis. Denitrification was compared between Bacillus cereus and Bacillus tequilensis in this study. Two bacilli were able to denitrify and Bacillus cereus was more efficient than Bacillus tequilensis. Bacillus cereus reduced 80% of high amount of nitrate; however, Bacillus tequilensis could reduce 37.4% of nitrate. These heterotrophic bacteria are able to eliminate organic matter with the same trend reducing 74.5% for Bacillus tequilensis and 70.2% for Bacillus cereus. Index Terms- Denitrification, Bacillus cereus, Bacillus tequilensis, 16S rRNA gene. I. INTRODUCTION enitrification is a respiratory process that couples electron transport phosphorylation with sequential reduction of nitrate to nitrogen through the intermediates nitrite, nitric oxide, and nitrous oxide (Delong et al. 2013). Biological denitrification is normally conducted by facultative anaerobes which are in essential need for some food and energy sources which are organic or inorganic (Cast and Flora, 1998; Rijn et al., 2006). This fact classifies denitrifiers into two main groups of heterotrophs and autotrophs. Heterotrophic denitrifiers use various organic carbons, such as methanol, acetate, or glucose that can serve as electron donors and carbon sources for growth. The beneficial aspects of denitrification include control or bioremediation of NO 3 - contaminated waters, which can cause eutrophication. However, nitrate has also been linked to stomach, cancer (Yang et al., 2007; Bouchard et al., 1992), and blue baby syndrome (Comly 1987). Denitrifiers may play an important part in the breakdown of various hydrocarbon compounds. Thus, biological denitrification constitutes an important way to reduce nitrogen oxides and organic matter in environment. Mostly Bacteria, and a few Archaea, constitute the vast majority of organisms capable of denitrification. A number of fungal isolates carry out reduction of nitrate to N 2 O, but the contribution of this reduction to cell growth is variable (Kim et al., 2009; Nakanishi et al., 2010). Some multicellular eukaryotes carry out denitrification (Risgaard-Petersen et al. 2006). Inspite of the fact that several Gram-positive bacteria are denitrifiers (Zumft, 1997; Manachini et al., 2000; Suharti & de Vries, 2005), the basics on denitrification within this group are understudied and they are notoriously overlooked in community analysis of denitrifiers in the environment because they are not targeted by the available PCR primers designed for denitrification genes (Throbäck et al., 2004). Verbaendert et al. (2011) have studied the denitrification of a large collection of Bacillus strains and suggested that denitrification occurred in nearly half of the analysed strains. More recently, a variety of bacilli were tested for gas production under denitrifying conditions and found to be complete denitrifiers (Jones et al., 2011). Genome sequencing has revealed the potential for partial denitrification in some Bacillus species. For example, qNor is present in Bacillus tusciae strain DSM2912 and some Bacillus licheniformis strains, but these are their only denitrification enzymes (Delong et al. 2013). In order to check the denitrification potential in anoxic denitrifying reactor, we isolated two cultures and compared their denitrification patterns to eliminate organic matter, reduction of nitrates and nitrites. The isolates were Bacillus cereus and Bacillus tequilensis, both isolated from biofilm of anoxic denitrifying reactor. Bacillus cereus and Bacillus tequilensis are known to be denitrifiers (Gaston et al., 2006; Verbaendert et al., 2011). II. MATERIALS AND METHODS II.1. Identification of denitrifying strains Isolates ADR1 and ADR2 were isolated from an anoxic denitrifying reactor treatment of domestic wastewater on nitrate– sucrose-agar (NSA) plates. Total DNA was extracted as described by Pitcher et al. (1989). The isolates were identified by molecular methods which consist to amplify the 16S rRNA gene of the strains by PCR and to determine 16S rDNA sequence by direct sequencing. The PCR amplification was performed with the primers pA (AGAGTTTGATCCTGGCTCAG) and pH (AAGGAGGTGATCCAGCCGCA) designed by Edwards et al. (1989) and used by other (McLaughlin et al., 2002). PCR amplification conditions were 95°C for 5 min followed by 30 cycles of 95°C for 40 s, 55°C for 1min, and 72°C for 2 min and a final 10-min extension step at 72°C. Sequencing of the PCR amplicon was done in ABI PRISM 3130XL Genetic Analyzer (Applied Biosystems) using the POP-7 polymer and ABI PRISM Genetic Analyzer Data Collection and ABI PRISM Genetic Analyzer Sequencing Analysis software.16S rRNA gene was compared with those available in EMBL database (https://www.ebi.ac.uk/Tools/sss/ncbiblast/nucleotide.html) using BlASTN. Reference and isolates sequences were aligned D