[CANCER RESEARCH 64, 7226 –7230, October 15, 2004] Advances in Brief COP1, the Negative Regulator of p53, Is Overexpressed in Breast and Ovarian Adenocarcinomas David Dornan, 1 Sheila Bheddah, 2 Kim Newton, 1 William Ince, 2 Gretchen D. Frantz, 2 Patrick Dowd, 3 Hartmut Koeppen, 2 Vishva M. Dixit, 1 and Dorothy M. French 2 Departments of 1 Molecular Oncology, 2 Pathology, and 3 Molecular Biology, Genentech, Inc., South San Francisco, California Abstract The tumor suppressor protein p53 plays a central role in protecting normal cells from undergoing transformation. Thus, it is fitting that cancer cells selectively dampen the p53 response to gain a selective growth advantage. In fact, the p53 gene is the most commonly mutated tumor suppressor gene in human cancers, and if the gene is not mutated, then other components of the p53 pathways are skewed to dampen the p53 response to stress. We recently identified COP1 as a novel and critical negative regulator of p53. COP1 is a RING finger-containing protein that targets p53 for degradation to the proteasome and is necessary for p53 turnover in normal and cancer cells. However, the association between COP1 and cancer remains to be determined. We performed expression analysis of COP1 in ovarian and breast cancer tissue microarrays. COP1 is significantly overexpressed in 81% (25 of 32) of breast and 44% (76 of 171) of ovarian adenocarcinoma as assessed by in situ hybridization and immunohistochemistry. Overexpression of COP1 correlated with a strik- ing decrease in steady state p53 protein levels and attenuation of the downstream target gene, p21, in cancers that retain a wild-type p53 gene status. Overall, these results suggest that overexpression of COP1 con- tributes to the accelerated degradation of p53 protein in cancers and attenuates the tumor suppressor function of p53. Introduction The role of p53 as a classical tumor suppressor has been well established. Biochemically, p53 functions as a stress-activated se- quence-specific transcription factor that activates transcription from promoters that harbor a p53 consensus-binding site (1). In addition, p53 also functions as a potent repressor of transcription, thereby adding an additional layer of gene regulation (2). As such, it protects cells from a variety of stress signals such as DNA damage, nucleotide depletion, and oncogene activation to name a few, by activating the transcription of a cadre of genes involved in cell cycle arrest, apopto- sis, and DNA repair in addition to repressing genes involved in angiogenesis, antiapoptosis, and cell cycle progression. The physio- logic consequence of p53 activation essentially leads to growth arrest, senescence, or apoptosis, thereby preventing cells from replicating a genetically compromised genome. The high frequency of alterations in the p53 gene or deregulated components of the p53 pathway in human malignancies underscores the importance of p53 integrity to prevent carcinogenesis. For exam- ple, in breast tumors the estimated frequency of gene alteration is only 20%, whereas this frequency dramatically increases to 70% in cases of small cell lung carcinomas (3). Within malignancies where the p53 gene is not mutated, other mechanisms may exist to attenuate its function as a tumor suppressor. p53 is rapidly turned over in unstressed cells by a proteasome- dependent pathway, and this is achieved by substrate recognition for the E3 ligases COP1(4), Pirh2 (5), and MDM2 (6, 7). The MDM2 gene has been shown to be up-regulated in tumors by gene amplifi- cation and overexpression. It has been suggested that overexpression of the negative regulator, MDM2, negates the requirement of cells to mutate p53 (8, 9). Surprisingly, the frequency of overexpression and/or amplification of MDM2 is relatively low in various cancers with a wild-type p53 gene status (9, 10), despite MDM2 harboring oncogenic properties (11). These data suggest that other mechanisms might also exist to dampen the p53 response independently of p53 gene mutation or MDM2 amplification or overexpression. Recently we identified COP1 as a critical negative regulator of p53 (4). Therefore, it is important to examine the relationship between COP1 expression and p53 status in human cancer. Our analysis of both COP1 and p53 at the DNA, mRNA, and protein levels reveals that COP1 is overexpressed in breast and ovarian carcinomas sug- gesting that it may promote tumorigenesis by inactivating a p53- dependent pathway. Materials and Methods p53 Gene Sequencing, Real-Time PCR, and Western Blotting. Tumor samples were isolated and resuspended in lysis buffer [1% SDS, 20 mmol/L Tris (pH 7.5), 2 mmol/L EDTA, and 400 mmol/L NaCl] and were supple- mented with 500 g/mL Proteinase K (Sigma) and incubated overnight at 55°C. DNA was extracted with phenol-chloroform-isoamyl alcohol (25:24:1). For the paraffin-embedded tissue microarray samples, DNA was extracted by incubating microdissected tumor tissue in 30 L of PicoPure Proteinase K extraction buffer (Arcturus, Mountain View, CA) for 48 hours at 65°C. The digest was heat inactivated at 95°C for 10 minutes and added directly to PCR reactions. Isolated genomic DNA was subject to PCR with the following primers for exons 5 to 8 of the p53 gene incorporating M13-specific sequences: Exon 5R (CAGGAAACAGCTATGACCAGCCCTGTCGTCTGTCCA), Exon 5F (TGTAAAACGACGGCCAGTTTCAACTCTGTCTCCTTC), Exon 6R (CAGGAAACAGCTATGACCTTAACCCCTCCTCCCAGAGA), Exon 6F (TGTAAAACGACGGCCAGTGCCTCTGATTCCTCACTGAT), Exon 7R (CAGGAAACAGCTATGACCTGTGCAGGGTGGCAAGTGGC), Exon 7F (TGTAAAACGACGGCCAGTAGGCGCACTGGCCTCATCTT), Exon 8R (CAGGAAACAGCTATGACCAGGCATAACTGCACCCTTGG), and Exon 8F (TGTAAAACGACGGCCAGTCCTTACTGCCTCTTGCTTCTC). PCR products were sequenced with M13F and M13R sequencing primers. Real-time PCR was carried out with specific probes for cop1, p21, and rpl19 as described previously (4) from total RNA isolated from normal and tumor samples. Tissues were harvested in tissue lysis buffer [0.5% NP40, 20 mmol/L Tris (pH 7.5), 5 mmol/L EDTA, and protease inhibitor mix; Roche, Mannheim, Germany] followed by homogenization. Nitrocellulose membranes were probed with antibodies to COP1, p53 (DO-1 and 1801, Santa Cruz Biotech- nology, Santa Cruz, CA), and actin (ICN, Irvine, CA). In situ Hybridization, Northern Blots, and Immunohistochemistry. Iso- topic in situ hybridization was performed on sections of paraffin-embedded Received 7/23/04; revised 8/19/04; accepted 8/24/04. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Requests for reprints: Dorothy M. French, Genentech, Inc., 1 DNA Way MS72B, South San Francisco, CA 94080. Phone: 650-225-2294; Fax: 650-225-8989; E-mail: dfrench@gene.com. ©2004 American Association for Cancer Research. 7226 Research. on July 20, 2015. © 2004 American Association for Cancer cancerres.aacrjournals.org Downloaded from