Plant Pathology (2005) 54, 262 Doi: 10.1111/j.1365-3059.2004.01154.x 262 © 2005 BSPP Blackwell Publishing, Ltd. NEW DISEASE REPORT The presence of both recombinant and nonrecombinant strains of Tomato yellow leaf curl virus on tomato in Réunion Island H. Delatte a *†, H. Holota a , F. Naze a , M. Peterschmitt b , B. Reynaud a and J.M. Lett a a CIRAD, UMR PVBMT CIRAD-Université de La Réunion, Pôle de Protection des Plantes, Ligne Paradis, 97410 Saint-Pierre, La Réunion; and b CIRAD, UMR BGPI, TA 41/K, 34398 Montpellier Cedex 5, France Tomato yellow leaf curl virus ( TYLCV) was first detected in Réunion in 1997, based on symptoms and partial sequence data between the conserved nonanucleotide and the first 5 ′ quarter of the capsid protein (CP) gene (Peterschmitt et al ., 1999). A 516 bp portion of the C4 gene of the same isolate of TYLCV from Réunion was subsequently sequenced (Accession No. AJ842312), showing that it belonged to the mild strain (TYLCV- Mld[RE]) and the so-called nonrecombinant group (Navas-Castillo et al ., 2000). In April 2004, severe symptoms of stunting, yellowing and leaf curling, resembling the symptoms of tomato yellow leaf curl disease, were observed on tomato plants in Saint Gilles in the north-west region of Réunion. Twenty-two leaf samples from affected tomato plants were collected and tested for the presence of begomovi- ruses using a PCR assay with two sets of primers designed to amplify two regions of the A component of TYLCV: primers V2790 and C837 amplify a 800 bp fragment spanning the intergenic conserved region (IR) nonanucle- otide sequence and two-thirds of the CP gene, while primers TY1944 (TTGTTTTGCCTGTTCTGCTA) and TY2460 (CATCTCCATGTGCTTATCCA) amplify a 516 bp portion of the C4 gene. The latter region was chosen to differentiate the Israeli strain (syn. TYLCV-IL Accession No. X15656) from the mild strain (TYLCV- Mld; Accession No. X76319). All the leaf samples produced PCR products of the expected size with both sets of primers. For three samples, a 483 bp fragment of the C4 gene was sequenced using the primer set TY1944/ TY2460 (Accession Nos AJ842309, AJ842310, AJ842311) and a 685 bp fragment of IR / CP region was sequenced using the primer set V2790 (ATCCGTATAATATTACCGGATGG) and C837 GCA- AATCATTCTTCACTGTTGC) (Accession Nos AJ842306, AJ842307, AJ842308). The sequences were aligned with those of known TYLCV strains using dnaman (Lynnon Biosoft, Quebec, Canada). The 685 bp fragment showed 98–99% nucleotide identity with TYLCV, TYLCV-Mld and -Mld[RE]. However, the 483 bp fragment showed a 98% nucleotide identity with TYLCV, but only 77% nucleotide identity with TYLCV-Mld and the previous Réunion isolate TYLCV-Mld[RE]. This is the first report of the presence of the Israeli strain, which belongs to the so-called recombinant group of TYLCV, from Réunion island. Acknowledgements This study was funded by the Conseil Régional de La Réunion. The technical assistance of M. Grondin is acknowledged. References Navas-Castillo J, Sanchez-Campos S, Noris E, Louro D, Acotto GP, Moriones E, 2000. Natural recombination between Tomato yellow leaf curl virus-Is and Tomato leaf curl virus. Journal of General Virology 81, 2797–801. Peterschmitt M, Granier M, Mekdoud R, Dalmon A, Gambin O, Vayssières JF, Reynaud B, 1999. First report of tomato yellow leaf curl virus in Réunion island. Plant Disease 83, 303. *To whom correspondence should be addressed. †E-mail: helene.delatte@cirad.fr Accepted 22 November 2004 at www.bspp.org.uk/ndr where figures relating to this paper can be viewed.