1 Appendix A. Supplementary data file 1 Distinct and extinct: genetic differentiation of the Hawaiian eagle Frank Hailer, Helen F. James, Storrs L. Olson, and Robert C. Fleischer 1. Details of laboratory and statistical analyses, and results from Bald Eagles Previous phylogenetic analyses have found extant Bald and White-tailed Eagles to be sister taxa, ǁith Stelleƌ’s Sea Eagles as the Ŷedžt ŵost ĐloselLJ ƌelated edžtaŶt liŶeage (Seibold and Helbig, 1996; Wink et al., 1996). Our phylogenetic analysis of the Hawaiian eagle lineage therefore includes mtDNA control region data from all these taxa. Pƌiŵeƌs used foƌ aŶĐieŶt DNA aŶalLJsis ǁeƌe ;all giǀeŶ iŶ 5’ to 3’ diƌeĐtioŶ; pƌiŵeƌs ǁith corresponding numbers in the names were used together): Hal-HVR1F (CCCCCCCTATGTATTATTGT), HalHVR-S1R (TGTATGCCCGRATTACAT), HalHVR-S2F (GACATATTAATGTATGTATTATAGTCA), HalHVR- S2R (CCTRTGGCATGGGTTTAG), HalHVR-S3F (TGCACTCTCGGACCATTT), HalHVR-S3R (GATCATGCAGA- AATCTGGTG), HalHVR-S4F (ACTACGGATCAGTGGACTGC), HalHVR-S4R (ATGATCTCTCTGGGACCGAC), HalHVR-S5F (CCAAGAAGGGCTAGGTTATCT), HalHVR-S5R (AGAGGCACAAAAGAGCAAGT), HalHVR-S6F (CGGTGCACGTATAGATCCTA), HalHVR-S6R (CAGTGAAGAGCGAGAGAACG). Except for the first primer (Hal-HVR1F; Hailer et al., 2007), all primers were newly designed for the purpose of this study. Amplifications of bald eagle DNA were done using the Hal-HVR1F and HalHVR-S6R primers in 15 µl reactions at 58°C annealing temperature, followed by sequencing as described above. PCRs using other primer combinations (Hal-HVR1F & HalHVR-S4R, Hal-HVR1F & HalHVR- -S5R, HalHVR-S2F & HalHVR-S6R, HalHVR-S4F & HalHVR-S6R; tested for a subset of samples) yielded identical results for bald eagles. The purpose of amplifying overlapping pieces of the control region using various primer combinations was to check for any mismatching DNA sequencing results among primer combinations. The latter, had it been observed, could have indicated that at least some primer combinations amplify nuclear copies of the control region rather than the mitochondrial fragment. We did not observe any mismatches in Bald Eagles, consistent with extensive tests in previous studies of Haliaeetus, which all failed to detect any signal challenging the true mitochondrial origin our analyzed fragment (Hailer et al., 2007, 2006; Honnen et al., 2010; Langguth et al., 2013). PCR amplifications were conducted in 25 µl reaction volumes in 1x of buffer II (Applied Biosystems) with3 µl of extract, 2 mM MgCl 2 , 1 unit of AmpliTaq Gold polymerase (Applied Biosystems), 1 mg/ml BSA, 1 µM of each primer, and 0.2 mM of each dNTP. PCR temperature profiles comprised 5 min at 95°C, 45 cycles of 30 sec at 95°C, 30 sec at 50°C and 1 min at 72°C, completed by a final elongation step of 10 min at 72°C. PCR products were cleaned using EXOSAP (USB Scientific). Both strands of DNA were cycle-sequenced with the PCR primers using BigDye v. 3.1 (Applied Biosystems), followed by Sephadex clean-up. Sequences were run on an ABI 3130xl instrument and assembled and edited in Sequencher 4.8.