Journal of Biomolecular NMR, 17: 177–178, 2000. KLUWER/ESCOM © 2000 Kluwer Academic Publishers. Printed in the Netherlands. 177 Letter to the Editor: Sequence-specific resonance assignments of Q83, a lipocalin highly expressed in v-myc-transformed avian fibroblasts Georg Kontaxis a,∗,§ , Theresia Matt b,∗ , Wolfgang Schüler a , Bernhard Kräutler a , Klaus Bister b & Robert Konrat a,∗∗ a Institute of Organic Chemistry and b Institute of Biochemistry, University of Innsbruck, A-6020 Innsbruck, Austria Received 22 February 2000; Accepted 4 April 2000 Key words: cell proliferation, NMR assignments, oncogenes, protein structure Biological context The protein product (c-Myc) of the protooncogene c- myc is a transcriptional regulator playing a key role in cellular growth control and differentiation. Deregu- lation of c-myc leads to oncogenic activation and cell transformation. However, the cellular targets mediat- ing the biological effects of Myc are largely unknown (Bister and Jansen, 1986; Grandori and Eisenman, 1997). We have isolated a cDNA clone (Q83) derived from a highly abundant mRNA in v-myc-transformed quail embryo fibroblasts. The deduced 178-amino acid protein product of Q83 contains an N-terminal signal sequence and a lipocalin sequence motif, the hallmark of a family of secretory proteins binding small hy- drophobic molecules (Flower, 1996). The quail Q83 protein displays 87% sequence identity with a devel- opmentally regulated chicken protein, termed p20K or Ch21 (Bedard et al., 1989; Cancedda et al., 1990). Here we report the sequence-specific assignments for a 157-amino acid recombinant protein representing the mature form of Q83. Methods and results Applying subtractive hybridization techniques (Bis- ter et al., 1993; Weiskirchen and Bister, 1993) to the identification of genes that are overexpressed in ∗ Both authors contributed equally. § Present address: Laboratory of Chemical Physics, National Insti- tute of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda, MD 20892, U.S.A. ∗∗ To whom correspondence should be addressed at the Institute of Organic Chemistry, University of Innsbruck, Innrain 52a, A-6020 Innsbruck, Austria. E-mail: robert.konrat@uibk.ac.at v-myc-transformed quail embryo fibroblasts, cDNA clone Q83 was isolated. A polymerase chain reaction (PCR) was performed using Q83 cDNA as a tem- plate and oligonucleotides 5 ′ -d(CA TAGT ACT GTG- CCGGACAGGAGCGAGATTG)-3 ′ and 5 ′ -d(TGG - ATCCATCCTATACTTCATCAACGGTGC)-3 ′ as 5 ′ and 3 ′ primers, respectively. The 5 ′ primer corre- sponds to nucleotides 66–96 of the Q83 cDNA se- quence (GenBank accession no. AF229030), with substitutions (underlined) introducing a novel ScaI site. The 3 ′ primer is complementary to nucleotides 523–552 of the cDNA sequence with substitutions in- troducing a novel BamHI site. The PCR product was digested with ScaI and BamHI, and the 475-nt frag- ment was ligated into plasmid pET3d that had been cut by NcoI, filled in by Klenow DNA polymerase, and then digested by BamHI. The expression plas- mid pET3d-Q83 encodes a 157-amino acid protein corresponding to the mature Q83 protein. Uniformly 13 C/ 15 N- or 15 N-labeled Q83 or unlabeled protein was obtained by growing BL21(DE3)pLysS bacteria trans- formed by pET3d-Q83 in minimal medium contain- ing 2 g [ 13 C]-D-glucose (CIL) and/or 15 NH 4 Cl (CIL) per liter, or the unlabeled components, respectively. Mass spectrometry and amino-terminal sequencing confirmed the identity of the purified recombinant protein and revealed that 40% of the protein sample lacked the N-terminal methionine. The final yield of labeled or unlabeled Q83 was 6.5–7.0 mg per liter of bacterial culture. For NMR analysis, protein samples were concentrated to 1.8–3.0 mM. NMR experiments were recorded at 26 ◦ C on a Varian Unity Plus 500 MHz spectrometer. The data were processed using NMRPipe (Delaglio et al., 1995) and analyzed using ANSIG (Kraulis, 1989).