This journal is c The Royal Society of Chemistry 2013 Chem. Commun., 2013, 49, 1817--1819 1817 Cite this: Chem. Commun., 2013, 49, 1817 pH dependent multifunctional and multiply- configurable logic gate systems based on small molecule G-quadruplex DNA recognition† Sudipta Bhowmik, ab Rabindra Nath Das, b Bibudha Parasar b and Jyotirmayee Dash* ab A variety of logic operations such as XNOR, NOR, AND, NAND, NOT have been designed with pH as an external modulator by choosing thiazole orange (TO) and a c-kit2 promoter quadruplex as two inputs and fluorescence signals of pyridyl bis-indole amide (PBIA) and TO as two outputs. The bio-molecular computing approach is now evolving as an innovative methodology to mimic electrical counterparts with the aid of Boolean algebra. 1 There has been immense interest in devising DNA logic gates in the past decade. 2 However, at present the practical applications of molecular logic gates are very limited, 3,4 as most of them suffer from one or more of the following limitations. To be a useful system, a logic gate should be (i) multifunctional (more than one output), (ii) multiply-configurable (more than one input), and (iii) responsive to biocompatible external physico-chemical stimuli (such as pH or some biocompatible molecules). G-quadruplex structural motifs are widespread in the human genome: in the telomeres and gene promoters. The versatility and stability of these structures have directed efforts towards exploring the applications of G-quadruplexes in both nanotechnology and biology. 5 A few attempts have also been made in the direction of G-quadruplex based molecular computing systems. Margulies and Hamilton reported a G-quadruplex–protein interaction based logic gate to monitor the protein concentration level. 6 Wang and Dong et al. reported logic gates based on relative affinity of the G-quadruplex towards cations. 7 Famulok and coworkers reported logic systems based on cation dependent structural conversion of nucleic acid helices. 8 Recently Li and coworkers have developed a set of logic gates based on assembly of G-quadruplex–hemin complex at an electrode surface. 9 The logic switches fabricated using G-quadruplexes reported to date suffer from problems either with flexibility or with the distinctively detectable signals. Herein, we have shown that such logic systems can be fabricated on the basis of different interaction modes of small molecules with the quadruplex topology. As a proof of principle, the interactions of small molecules such as pyridyl bis-indole amide (PBIA) 1, thiazole orange (TO) 2 among themselves and with the c-kit 2 promoter quadruplex sequence d[GGGCGGGCGCGAGGGAGGGG] (Fig. 1) have been manifested to devise XNOR, NOR, AND, NAND and NOT logic gates with pH as an external modulator. Recently we have developed a series of selective G-quadruplex binding ligands based on a bis-indole central core where the presence of the carboxamide side chains in the para position of the indole NH demonstrates high stabilisation potential for the G-quadruplexes. 10 PBIA 1, which exhibits emission at 440 nm (quantum yield F = 0.12, abs, l max = 256, 342 nm), was our primary choice of interest for the subsequent pH dependent ligand– quadruplex binding investigation. When the fluorimetric titration of 1 (2.5 mM) was performed at pH 7.4 with increasing concentration of c-kit 2 (1–8 mM), the fluorescence intensity of 1 was quenched upon interaction with the quadruplex (Fig. S1b, ESI†) possibly by the end stacking binding mode, where the pyridyl bis-indole core covers a larger surface of the G-quadruplex. The binding constant ( K d ) of 1 with c-kit 2 was then calculated to be 1.39 mM from the fluorimetric titration graph (Fig. S2, ESI†). Fluorescence Intercalator Displace- ment (FID) assay 11 was also carried out and the binding constant ( K d ) of 1 was found to be 1.4 mM which was in agreement with the fluorescence quenching titration (Fig. S10, ESI†). Fig. 1 Structures of the interacting components: PBIA 1, TO 2 and c-kit2 quadruplex (PDB entry: 2KQG) in the logic systems. a Department of Organic Chemistry, Indian Association for the Cultivation of Science, Jadavpur, Kolkata-700032, India. E-mail: ocjd@iacs.res.in; Fax: +91-33-2473-2805; Tel: +91-33-2473-4971, ext 1405 b Department of Chemical Sciences, Indian Institute of Science Education and Research Kolkata, Mohanpur, West Bengal 741252, India † Electronic supplementary information (ESI) available: Fluorimetric titration data, FID assay and CD spectroscopic studies. See DOI: 10.1039/c3cc38888c Received 12th December 2012, Accepted 14th January 2013 DOI: 10.1039/c3cc38888c www.rsc.org/chemcomm ChemComm COMMUNICATION Downloaded by Indian Institute of Science Education & Research Kolkata on 14 February 2013 Published on 14 January 2013 on http://pubs.rsc.org | doi:10.1039/C3CC38888C View Article Online View Journal | View Issue