Research Letters AIDS 2002, 16:1959–1980 Evolution of the gp41 env region in HIV-infected patients receiving T-20, a fusion inhibitor Eva Poveda, Berta Rode ´s, Carlos Toro, Luz Martı ´n- Carbonero, Juan Gonzalez-Lahoz and Vincent Soriano T-20 belongs to a new family of antiretroviral drugs that inhibits HIV entry. Resistance may develop in vitro as result of changes within the GIV motif of the HIV-1 gp41. However, none of four individuals who failed treatment with T-20 selected those changes. One developed a change (G V) at position 36 not previously described. Therefore, other changes in the env gene might be responsible for the loss of susceptibility to T- 20 in vivo. T-20 is a 36 amino acid synthetic peptide that mimics the HR2 region of the HIV-1 gp41. Its mechanism of action is little understood but it seems to interact competitively with HR1 to prevent the fusion of viral and cellular membranes [1]. Few data are available on the evolution of the env gene in patients undergoing treatment with T-20. In-vitro studies have defined a highly conserved three amino acid motif, GIV, within the HR1 region of gp41 to be critical for the loss of susceptibility to T-20 [2]. In particular, two changes in this motif at positions 36 (G!S) and 38 (V!M) have been associated in vitro with resistance to T-20. The purpose of this study was to analyse the possible changes in the gp41 env region potentially associated with resistance to T-20 in clinical samples collected from HIV-positive patients failing therapy with T-20. Four heavily pre-treated patients, with multiple mutations associated with resistance to both protease and reverse transcriptase (RT) inhibitors, who received T-20 were included in the study. Genotypic and phenotypic resis- tance tests (Virologic, San Francisco, CA, USA) were performed at baseline. The antiretroviral drugs planned to be used along with T-20 were chosen individually on the basis of the results of resistance testing. T-20 (Roche Pharmaceuticals, Nutley, NJ, USA) was administered subcutaneously twice a day at doses of 100 mg every 12 h. One patient (no. 2) discontinued T-20 at month 5 as a result of adverse events. Genetic analyses were performed on HIV RNA ex- tracted from the plasma from each individual. Speci- mens collected at baseline and at 2–3 month intervals while under T-20 were examined. A gp41 fragment (567 base pairs) that included HR1 and HR2 genomic regions was amplified by RT-nested polymerase chain reaction using E41ext1 59 –GAGAAGAGTGGTGCA GAGAG–39 and E41ext2 59 –ATTCCTTCGGGCCT GTCGGG–39 as outer primers, and E41int1 59 – GCAGCAGGAAGCACTATGGGCG–39 and E41int2 59 –GGTGARTATCCCTGCTAACTC–39 as inner primers. The amplicon was sequenced in both direc- tions using the dRhodamine Terminator Cycle Se- quencing kit (Applied Biosystems, Foster City, CA, USA), and sequences were aligned using Clustall X. Plasma HIV-RNA levels and CD4 cell counts were monitored monthly. All four patients experienced a significant decrease in viral load (. 1 log) within the first month of therapy with T-20 (patient 1: 1.89 logs; patient 2: 1.66 logs; patient 3: 1.17 logs; and patient 4: 1.75 logs). However, be- tween months 2 and 3, the viral loads rebounded up to baseline values in all cases. At the initiation of treat- ment with T-20, the mean CD4 cell count was 217 86.5 cells/ìl, and remained without significant change during the whole study period in all but one individual (no. 4), in whom a net gain of 199 cells/ìl was recorded (Fig. 1). DNA sequence analyses and the encoded protein sequences of gp41 revealed that all four patients carried a consensus GIV motif at baseline. The intrapatient variability in gp41 sequences during treatment with T- 20 was low, ranging from 0 to 0.5%, and resulting almost always in synonymous substitutions. None of the sequences analysed harboured amino acid changes previously associated with resistance to T-20 in vitro, not even after 9 months of virological failure. How- ever, one subject (no. 1) developed a change G!V at position 36 at month 7, although being on T-20. The viral loads and CD4 cell counts during follow-up did not differ in this patient in respect to the others. Another subject (no. 3) presented with three changes (Q110Q/E, E119E/Q and R122R/K) within the HR2 domain after 9 months on T-20. Sequences generated in this study have received the following GenBank accession numbers: AF500084–AF500093. A GenBank database search has so far not recorded the G36V change in the GIV motif of the HR1 region in any of the reported sequences. Moreover, to our knowledge no gp41 sequences from patients receiving T-20 have shown amino acid substitutions in the GIV motif. The recognition of non-conservative amino acid substitutions in the HR2 genomic region may equally be involved in the loss of susceptibility to T-20, ! ISSN 0269-9370 & 2002 Lippincott Williams & Wilkins 1959