Molecular Ecology Notes (2005) 5, 841– 843 doi: 10.1111/j.1471-8286.2005.01081.x © 2005 Blackwell Publishing Ltd Blackwell Publishing, Ltd. PRIMER NOTE DNA microsatellites in Acanthochromis polyacanthus VANESSA MILLER-SIMS,* MARTHA DELANEY,† JELLE ATEMA,* MICHAEL KINGSFORD‡ and GABRIELE GERLACH† * Boston University Marine Program, Woods Hole, MA 02543-1015, USA, † Marine Biological Laboratory, Woods Hole, MA 02543- 1015, USA, ‡ School of Marine Biology and Aquaculture, James Cook University, Queensland, Qld 4811, Australia Abstract To determine genetic substructuring in populations of the spiny damselfish Acanthochromis polyacanthus among different reefs of the Great Barrier Reef, Australia, we characterized six polymorphic microsatellite loci. Keywords: Acanthochromis polyacanthus, connectivity, dispersal, microsatellites, pomacentrid Received 25 April 2005; revision accepted 13 May 2005 One of the fundamental questions in marine biology is the effect of life history characteristics such as pelagic larval dispersal on the genetic structure of populations. The lack of a larval dispersal phase should enhance geographical isolation in contrast to the generally broad geographical distribution of coral reef fish. Among 335 species of Poma- centridae, only three species lack a larval dispersal phase: Altrichthys azurelineatus , Altrichthys curatus and Acantho- chromis polyacanthus (Bernardi & Vagelli 2004). Larvae and juveniles of the spiny damselfish, Ac. polyacanthus , are defended by their parents until they are large enough to be on their own (Robertson 1973; Thresher 1985). The distribution of colour morphs, allozyme electrophoresis, and analysis of mitochondrial DNA (mtDNA) cytochrome b sequences suggest minimal dispersal in this species (Doherty et al . 1994; Planes et al . 2001). We want to evaluate population subdivision in Ac. polyacanthus with microsatellite markers to study genetic exchange on a very small geo- graphical scale of 1–10 km. Microsatellite markers were identified using a standard bead hybridization protocol with some modifications (Tenzer et al . 1999; Garner et al . 2000). Genomic DNA was isolated from homogenized Ac. polyacanthus tissue using DNAzol BD (Molecular Research Center, Cat. no. DN 129). The resulting 50 μ g DNA was digested with the restriction enzyme Tsp 509 I following the manufacturer’s recom- mendations. A 300 – 800 bp size fraction was isolated from a low melting point multipurpose agarose (Boehringer) gel and purified using an ultrafree DNA spin column (Millipore) followed by ethanol precipitation. This isolate was used for ligation with TSPADSHORT/TSPADLONG linkers (TSPADSHORT: CGGAATTCTGGACTCAGTGCC and TSPADLONG: AATTGGCACTGAGTCCAGAATTCCG) (Tenzer et al . 1999) with an overhang (TTAA) that comple- mented the restriction enzyme overhang. The product was amplified via polymerase chain reaction (PCR), using TSPADSHORT as a primer. PCR was performed using the following conditions: total reaction volume was 25 μ L included 100 ng DNA, 1 U Red Taq polymerase (Sigma), 2.5 μ L 10 × RED Taq Polymerase Buffer (Sigma), 100 μ m of each dNTP (Promega) and 1 μ m TSPADSHORT. PCR was performed on a thermocycler (Eppendorf Mastercycler) using the following thermo-treatment: 2 min at 72 ° C, followed by 25 cycles of 1 min at 94 ° C, 1 min at 55 ° C and 1 min at 72 ° C. A total of 46 PCRs were carried out, pooled, cleaned with the QIAquick PCR Purification Kit (QIAGEN) and concentrated to minimize the likelihood of redundant products being detected during screening for positive clones. PCR products were hybridized to biotinylated (CA) 15 or (GA) 15 probes bonded to streptavidin-coated magnetic beads Dynabeads M-280 Streptavin (Dynal Biotech) and amplified again. These final PCR products were cloned following the Original TA Cloning Kit (Invitrogen) protocol. White colonies were picked and the size of the insert was determined after amplification using TSPADSHORT as primers under the conditions described above. A plasmid preparation (Plasmid Prep Kit, QIAGEN) was performed on 33 clones that showed an insert larger than 200 bp. These plasmids were sequenced following the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit protocol, version 2.0 (PE Biosystems) using M13 forward and reverse primers, and using the ABI 377 automated sequencing system (PE Biosystems). Six clones showed Correspondence: G. Gerlach, Fax: (508) 289 7900; E-mail: ggerlach@mbl.edu