http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–5 ! 2013 Informa UK Ltd. DOI: 10.3109/19401736.2013.834438 SHORT COMMUNICATION DNA barcoding of gobiid fishes (Perciformes, Gobioidei) Divya Viswambharan 1 , A. Pavan-Kumar 1 , Dhirendra P. Singh 1 , A. K. Jaiswar 1 , S. K. Chakraborty 1 , J. Rajashekharan Nair 2 , and W. S. Lakra 1 1 Division of Fish Genetics and Biotechnology, Central Institute of Fisheries Education, Mumbai, Maharashtra, India and 2 Department of Fishery Biology, Kerala University of Fisheries and Ocean Studies, Kochi, Kerala, India Abstract Gobiids constitute a major proportion of fish population in both tropical and temperate freshwater as well as marine ecosystem. Due to their small size, cryptic ecology and ambiguous morphological characters, gobiids diversity was not documented completely. In this study, DNA barcodes were generated for 11 species of gobiids, collected from the Ashtamudi Lake, India. The mitochondrial COI gene was amplified using universal primers and the resulted 650 bp amplicon was sequenced. The COI barcodes clearly distinguished all the species with high inter- specific genetic distance values than intra-specific values based on K2P (Kimura 2 Parameter) model. The average genetic distance (K2P model) within species, genus and family was 1.2%, 22.2% and 25.3%, respectively. In addition to barcode-based species identification system, Nucleotide Diagnostic (ND) characters specific for species were identified. The Neighbor-Joining tree revealed distinct clusters shared by the species of same genera. Keywords Cytochrome c oxidase subunit I, DNA barcoding, gobiid fishes, nucleotide diagnostic characters History Received 2 May 2013 Revised 5 August 2013 Accepted 10 August 2013 Published online 17 September 2013 Introduction Gobiids are estimated to constitute 35% of the total number of fishes and 20% of the species diversity and they occupy both tropical and temperate environment (Winterbottom et al., 2011). However, due to their small size and often cryptic ecologies, the gobiid diversity was not characterized completely and was often unnoticed. The traditional morphological tools for species iden- tification are constrained by phenotypic plasticity, life stage- specific identification cues and the occurrence of cryptic species. DNA-based approach exploiting sequence diversity among spe- cies can be used to identify fishes and to resolve taxonomic ambiguities. Hebert et al. (2004) have demonstrated that the Cytochrome c oxidase subunit I (COI) region is appropriate for discriminating closely related species across diverse animal phyla and this has been used for marine as well as freshwater fishes widely (Hajibabaei et al., 2005; Hubert et al., 2008; Lakra et al., 2011; Steinke et al., 2005; Ward et al., 2008). This work was carried out with an objective of developing DNA barcodes for Gobiids from Ashtamudi Lake, the second largest wetland ecosystem in India. The aim of the study also includes analyzing Nucleotide diagnostics (NDs) characters for these fishes and supplementing the BOLD database with Indian haplotypes as there is lack of species-specific information. Materials and methods A total of 29 Gobiid specimens belonging to 11 species were collected from the Ashtamudi Lake (Lat 8.95  N and Long 76.6  E) in Kerala, India, for which the taxonomy and GenBank accession numbers are provided (Table 1). The specimens were identified based on morphological characters using ‘‘Smiths’ sea fishes’’ (1986) and preserved in absolute alcohol for further molecular study. Total genomic DNA was isolated from the muscle tissue according to the SDS-phenol/chloroform method of Sambrook et al. (2001) with some modifications. The cytochrome c oxidase subunit I (COI) gene was amplified with primers FishF1-5 0 TCAACCAACCACAAAGACATTGGCAC 3 0 and FishR-1 5 0 TAGACTTCTGGG TGGCCAAAGAATCA 3 0 (Ward et al., 2005) in a 50-ml volume with 100 ng template DNA, 10 pmol of each specific primer, 200 mM of each dNTPs, 1.0 unit of Taq DNA polymerase and 1x Taq buffer containing 1.5 mM MgCl 2 . The PCR conditions were initial denaturation at 94  C for 3 min, followed by 35 cycles of 40 s at 94  C, 40 s at 54  C, 60s at 72  C and final extension at 72  C for 10 min. The PCR products were visualized on 1.5% agarose gel and the amplicons were purified by Gel extraction kit (Fermentas, Waltham, MA) following the manufacture’s protocol. The purified products were sequenced commercially by Eurofins Pvt Ltd., Bangalore, India. Sequence analysis The COI partial gene sequences obtained for each species were manually assembled using Generunner software (New York, NY). Assembled sequences were end-trimmed to a homologous region to avoid sequencing errors and aligned using Clustal W (Thompson et al., 1997). Only those sequences with more than 550 bp in size were used for the analysis. Sequence divergence values within and between species were calculated using Kimura two Parameter (K2P) distance model implemented in MEGA V.5.0 (Tamura et al., 2011) software (Arizona). The pair-wise deletion option was selected to account for missing sequence information between each compared specimen. Nucleotide Diagnostics (NDs) for each species of interest were identified in the context of the entire pool of available species by MEGA Correspondence: A. Pavan Kumar, Scientist, Division of Fish Genetics and Biotechnology, Central Institute of Fisheries Education, Versova, Andheri West, Mumbai-61, Maharashtra, India. Tel: 022-26361447, Ext. 452. E-mail: pavankumar@cife.edu.in Mitochondrial DNA Downloaded from informahealthcare.com by 14.139.124.98 on 09/19/13 For personal use only.