Downloaded from www.microbiologyresearch.org by IP: 54.221.100.114 On: Tue, 02 Aug 2016 12:54:11 Journal of General Virology (1998), 79, 3027–3031. Printed in Great Britain .......................................................................................................................................................................................................... SHORT COMMUNICATION Identification and characterization of the herpes simplex virus type 1 UL51 gene product Tohru Daikoku, Kazuteru Ikenoya, Hiroshi Yamada, Fumi Goshima and Yukihiro Nishiyama Laboratory of Virology, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Tsurumai-cho, Showa-ku, Nagoya 466, Japan The products of the herpes simplex virus type 1 UL51 gene were identified as phosphoproteins with apparent molecular masses of 27, 29 and 30 kDa. The proteins were produced at the late stage of infection, in a manner highly dependent on viral DNA synthesis, and were associated with extra- cellular virions. Immunofluorescence studies local- ized the UL51 proteins mainly to the cytoplasm, both in infected Vero cells and in transfected COS- 1 cells singly expressing the UL51 gene. Herpes simplex virus (HSV) is a large, enveloped DNA virus and the genome contains at least 84 different genes (Roizman et al., 1996). Approximately half of these genes have been shown to be dispensable for virus replication in cell cultures, but the proteins encoded by these dispensable genes are considered to play important roles in various aspects of virus growth and spread in the host. Although recent studies have identified most of the dispensable genes of HSV (Roizman & Sears, 1996 ; Roizman et al., 1996), the precise functions of many gene products remain obscure. The UL51 gene of HSV- 1 is one of the dispensable genes that are located at the right end of the unique long (U L ) region of the virus genome (Barker & Roizman, 1990 ; McGeoch et al., 1988) and its gene homologues are conserved throughout the herpesvirus family (Albrecht et al., 1992 ; Baer et al., 1984 ; Baumeister et al., 1995 ; Chee et al., 1990 ; Davison & Scott, 1986 ; Gompels et al., 1995 ; Telford et al., 1992). The HSV-1 UL51 gene is predicted to encode a protein of 244 amino acids and its homologues have similar molecular size. Recently, Lenk et al. (1997) identified the UL51 product of pseudorabies virus (PRV), one of the alphaherpesviruses, and demonstrated that the 30 kDa product is a virion component and mainly localized in the nuclei of infected cells. To our knowledge, however, there are no reports concerning the UL51 protein of HSV, although defects in the gene have been shown to be associated with a small plaque phenotype (Barker & Roizman, 1990). The present study was Author for correspondence : Yukihiro Nishiyama. Fax 81 52 744 2452. e-mail ynishiyatsuru.med.nagoya-u.ac.jp undertaken to identify and characterize the product of the HSV-1 UL51 gene. To identify the UL51 protein, we first generated anti-UL51 rabbit antisera by using a recombinant HSV-1 UL51 fusion protein as antigen. Plasmid pET28-UL51 was constructed for this purpose, as described previously (Daikoku et al., 1997; Yamada et al., 1997). Briefly, the UL51 coding sequence was cloned by PCR amplification from HSV-1 KOS genomic DNA, with UL51f (5 AACGTCGACTTATTGACCCAAAACA- CAC) as the forward primer and UL51r (5 CCGGAATTC- ATGGCTTCTCTTCTCGGGGC) as the reverse primer. SalI and EcoRI sites were incorporated into the forward and reverse primers, respectively, to facilitate cloning. The PCR product was digested with SalI and EcoRI and then cloned in-frame and downstream of the region encoding the initiating ATG plus six histidine (6His) residues in the E. coli expression vector pET- 28a (Novagen), to give pET28-UL51. The UL51 fusion protein, with an apparent molecular mass of 32 kDa, was then expressed in E. coli following treatment with IPTG (Fig. 1 A), purified with the Prep Cell system (Bio-Rad), and the purified fractions were used to immunize three rabbits as described previously (Daikoku et al., 1997). The reactivity and specificity of the antisera were examined by Western blotting (Fig. 1 B). One of the antisera reacted strongly to proteins with molecular masses of 27 and 29 kDa in the lysate of HSV-1-infected Vero cells. This antiserum also reacted to proteins with molecular masses of 28 and 30 kDa in HSV-2-infected cell lysates, and these protein bands could not be detected in mock-infected cell lysates (Fig. 1 B, lane 4). The reactivity of the antiserum to these proteins was clearly eliminated by pre-adsorption of the antiserum with a lysate from E. coli expressing the UL51 fusion protein (Fig. 1B, lanes 9 and 10), but there was no marked change in the reactivity to these protein bands after pre- adsorption with a lysate from control E. coli (Fig. 1B, lanes 7 and 8). Preimmune rabbit serum did not react to any specific proteins in HSV-1- or HSV-2-infected cells (Fig. 1 B, lanes 2 and 3). These results indicate that the antiserum could detect the UL51 protein specifically in HSV-1- and HSV-2-infected cells ; we therefore used this polyclonal antiserum for further experiments to characterize the HSV-1 UL51 gene product. The time-course of UL51 protein synthesis in HSV-1- infected Vero cells was analysed by Western blotting. At 0001-5743  1998 SGM DACH