Journal of General Virology (1994), 75, 18%192. Printed in Great Britain 189 Expression of the human cytomegalovirus 65K tegument phosphoprotein in insect cells by baculovirus vectors G. La Fauci,* V. J. Sapienza, C. J. Chen, H. M. Wisniewski and K. S. Kim New York State Institute for Basic Research in Developmental Disabilities, 1050 Forest Hill Road, Staten Island, New York 10314, U.S.A. The gene encoding the 65K tegument phosphoprotein (pp65) of human cytomegalovirus (HCMV) was cloned into pAc373 to construct a recombinant baculovirus (Acpp65-3) expressing pp65 in insect Sf9 cells. A baculovirus that carried a fragment of the gene, corresponding to the first 442 amino acids ofpp65, was also developed, using vector pVL941 (Acpp65-2). Recombinant proteins migrating in SDS- polyacrylamide gels with an M r of either 65K (Acpp65- 3) or 56K (Acpp65-2) were detected in cytoplasmic and nuclear extracts of infected Sf9 cells. The 56K and 65K proteins were recognized in immunoblots by monoclonal antibodies (MAbs) 28-77 and 28-19, which are specific for pp65. The insect cell-expressed antigens were also analysed on Western blots using MAbs 4D11, 7D2, 8E3, 7B4 and 8El0, which recognize the HCMV antigen GP66 in immunoblots. The truncated pp65 antigen of Acpp65-2 was reactive with MAbs 4Dll, 7D2, 8El0 and 7B4. The protein expressed by Acpp65-3 reacted only with MAb 4D11. The data proved that the epitopes recognized by MAbs 4Dll, 7D2, 8E3 and 7B4 mapped in the region ofpp65, comprising amino acids 1 to 442, and also that GP66 and pp65 represent the same HCMV antigen. Immunoblot analysis of human sera from individuals seropositive for HCMV showed that the recombinant pp65 products were as antigenic as the native 65K phosphoprotein produced in HCMV- infected human embryonic fibroblasts. Human cytomegalovirus (HCMV) causes serious disease in immunocompromised individuals and in patients receiving immunosuppressive therapy. The virus is also one of the most common known causes of congenital mental retardation, blindness and deafness. The HCMV particle contains at least 33 structural proteins, several of which are glycosylated or phosphorylated (Kim et al., 1976). The most abundant of these virus-encoded proteins is the 65K tegument phosphoprotein (pp65) (Nowak et al., 1984; Ruger et al., 1987), which probably corresponds to the major viral polypeptide GP66 described by Kim et al. (19831). This phosphoprotein has also been designated the lower matrix protein (Gibson, 1983), gp64 (Gibson, 1983; Clark et al., 1984; Forman et al., 1985; Pande et al., 1984) and ICP27 (Geballe et al., 1986). Numerous reports have described pp65 as one of the HCMV proteins most frequently recognized on Western blots by human sera from individuals sero- positive for the virus (Landini et al., 1985; Jahn et al., 1987; Klages et al., 1989; Landini & LaPlaca, 1991). In an effort to elucidate the role of pp65 in HCMV infections and to construct biological reagents for the detection of antibodies against this antigen, we expressed the phosphoprotein in Spodopterafrugiperda Sf9 cells by using baculovirus vectors. The nucleotide sequence of the pp65 gene of HCMV strain AD-169 (Ruger et al., 1987) was used to design oligonucleotide primers for PCR. The pair of primers B66-S1 (5' ATGCGCGGAT- CCATGGAGTCGCGCGGTCGCCGTTGT 3") and 66-A4 (5" GCCGAGGATGCTGATTTGCGTTTG 3') was designed to amplify a 1328 bp DNA fragment carrying the portion of the gene encoding the first 442 amino acids (1326 bp). Primers B66-S1 and B66-A0 (5' CCCGGGATCCATAGAGTCGTCCTAAGCGC- GT 3') were used to amplify a 1719 bp DNA fragment containing the entire pp65 gene (1686 bp). PCR was done in 100 ~tl final volume containing 50 ng of HCMV (Towne) DNA, using the standard protocol of Saiki (1989). The 1328 bp and 1719 bp DNA fragments were cloned into the BamHI site of baculovirus transfer vectors pVL941 and pAc373, respectively (Summers & Smith, 1987; Luckow & Summers, 1989). The resulting plasmids were used to develop baculoviruses Acpp65-2 (1328 bp pp65 insert) and Acpp65-3 (1719bp pp65 insert) according to the method of Summers & Smith (1987). The recombinant baculoviruses were then plaque- purified four times and used to propagate viral stocks. To determine whether cells infected with the recombin- ant viruses produced the appropriate proteins and to study the cellular location of the baculovirus-expressed (bpp65) antigens, Sf9 cells at 41 h post-infection were labelled with 25 laCi/ml Tran ~SS-label (ICN) for 4 h 0001-1806 © 1994 SGM