Regeneration and Tolerance Factor: A Novel Mediator of Glioblastoma-Associated Immunosuppression Patrick Roth, 1 Steffen Aulwurm, 1 Isabella Gekel, 1 Dagmar Beier, 1 Roxanne G. Sperry, 3 Michel Mittelbronn, 2 Richard Meyermann, 2 Kenneth D. Beaman, 3 Michael Weller, 1 and Jo ¨rg Wischhusen 1 1 Laboratory of Molecular Neuro-Oncology, Department of General Neurology, Hertie Institute for Clinical Brain Research, and 2 Institute for Brain Research, University of Tu ¨bingen, Medical School, Tu ¨bingen, Germany and 3 Clinical Immunology Laboratory, Department of Microbiology/Immunology, Rosalind Franklin University of Medicine and Science, North Chicago, Illinois Abstract Regeneration and tolerance factor (RTF) was originally identified in placenta where it is thought to be essential for fetal allograft survival. Here we report that RTF mRNA and protein are also expressed in human glioma cells in vitro and in vivo . Suppression of RTF expression by RNA interference promotes the lysis of glioma cells by natural killer (NK) and T cells in vitro . Moreover, RTF-depleted glioma cells are less tumorigenic than control cells in nude mice in vivo . Depletion of NK cells in these animals abolished this effect. RTF is thus a novel aberrantly expressed molecule which confers immune privilege to human malignant gliomas. (Cancer Res 2006; 66(7): 3852-8) Introduction Human glioblastoma is a highly lethal tumor that is paradig- matic for tumor-dependent immunosuppression (1, 2). Human glioma patients exhibit distinct deficits in cellular immunoreactiv- ity. Despite the highly malignant cellular phenotype of glioma cells, these tumors rarely metastasize outside the brain but kill patients by locally destructive growth in the central nervous system. Intriguingly, several case reports of glioblastomas developing in recipients of peripheral organ transplants (3) illustrate that some glioma cells leave the brain and populate the periphery. Because such cells are incapable of forming clinically apparent metastases, they are possibly eliminated by the immune system in the periphery but not in the immunoprivileged site of their origin, the brain. We have previously shown that glioblastoma cells express activatory natural killer (NK) and costimulatory T-cell ligands (4). However, inhibitory signals, notably transforming growth factor-h (TGF-h; refs. 5, 6) but also interleukin (IL)-10 (7), HLA-G (8), and B7-H1 (9), seem to dominate tumor-host interactions in vivo . More effective antitumor responses might be induced either by providing additional immune stimulation or by antagonizing tumor-derived immune inhibition. Regeneration and tolerance factor (RTF; alternative name: TJ6) is a 70-kDa cell-surface protein first identified in peripheral cytotrophoblasts of early placentas (7-9 weeks; ref. 10). However, RTF transcripts have recently also been described in a broad spectrum of tissues with levels being lowest in brain and spinal cord (11). RTF is cleaved to yield a membrane-bound 50-kDa protein and a secreted, biologically active 20-kDa fragment (soluble RTF). Soluble RTF up-regulates the production of IL-10 and interferes with IL-2 signaling in peripheral blood mononuclear cells (PBMC) stimulated with anti-CD3 antibody (12), thus shifting the balance towards a Th2 T-cell response. RTF is physiologically expressed in activated PBMC. Because neutralizing RTF antibodies induce apoptosis in activated T cells (13), RTF may limit T-cell activation and thus prevent activation-induced cell death. A tolerogenic function of RTF is strongly supported by the reversal of fetal semi-allograft tolerance in mice treated with a monoclonal antibody (mAb) to RTF/TJ6. This treatment completely ablates pregnancy at early stages (14). An aberrant expression of membrane-bound RTF has been described in B-cell lymphomas (15) but not yet in solid tumors. Materials and Methods Cells and reagents. The human glioma cell lines, kindly provided by Dr. N. de Tribolet (Lausanne, Switzerland), have previously been characterized (16). The LN-229 cells used in this study have, unlike LN-229 cells grown in other laboratories, retained wild-type p53 function and were therefore renamed LNT-229 for clarification (T for Tu ¨bingen; ref. 17). Primary glioblastoma cells were established from freshly resected tumors, cultured in monolayers, and used between passages 4 and 9 (18). The cells were maintained in DMEM containing 10% FCS (Biochrom KG, Berlin, Germany) and penicillin (100 IU/mL)/streptomycin (100 Ag/mL; Life Technologies, Inc., Karlsruhe, Germany). RPMI 8866 cells were cultured in RPMI 1640 containing 10% FCS, 2 mmol/L L-glutamine, 1 mmol/L sodium pyruvate, and antibiotics. The pSUPER plasmid was obtained from R. Agami (Amsterdam, the Netherlands). A puromycin cassette was inserted into the Nae I site. The RTF-specific oligonucleotide sequences GATCCCC CAT- CGTGGATGCTTATGGAttcaagaga TCCATAAGCATCCACGATGTTTTTG- GAAA and TCGATTTCCAAAAA CATCGTGGATGCTTATGGAtctcttgaa TC- CATAAGCATCCACGATGGGG [nucleotides (nt) 1,148-1,166], GATCCCC- GGCCATCTATCACATGCTGttcaagaga CAGCATGTGATAGATGGCC- TTTTTGGAAA and TCGATTTCCAAAAA GGCCATCTATCACATGCTG- tctcttgaa CAGCATGTGATAGATGGCCGGG (nt 923-941) were obtained from Metabion (Munich, Germany) and cloned into the Bgl II and Sal I sites of pSUPER. The RTF-specific parts of the sequences are underlined. For the generation of stable siRTF transfectants, pSUPERpuro control or siRTF plasmids were introduced using FuGene6 transfection reagent (Roche, Mannheim, Germany). The cells were selected in medium containing 2 Ag/ mL puromycin (Sigma, Deisenhofen, Germany). For transient transfections, 2  10 5 LN-308 cells were seeded in a six-well plate. Twenty-four hours later, they were transfected with 10 nmol/L of either RTF siRNA, 5V -CAUCGUG- GAUGCUUAUGGA(dTdT)-3V and 5V -UCCAUAAGCAUCCACGAUG(dTdT)-3V , or irrelevant GL3 control siRNA, 5V -CUUACGCUGAGUACUUCGA(dTdT)-3V and 5V -UCGAAGUACUCAGCGUAAG(dTdT)-3V , using TransIT-TKO Transfec- tion Reagent (Mirus, Madison, WI). Cells were analyzed and used for Requests for reprints: Patrick Roth, Department of General Neurology, Hertie Institute for Clinical Brain Research, University of Tu ¨bingen, Medical School, Hoppe- Seyler-Strasse 3, 72076 Tu ¨bingen, Germany. Phone: 49-7071-2981960; Fax: 49-7071- 295742; E-mail: patrick.roth@uni-tuebingen.de. I2006 American Association for Cancer Research. doi:10.1158/0008-5472.CAN-05-3062 Cancer Res 2006; 66: (7). April 1, 2006 3852 www.aacrjournals.org Research Article Research. on July 1, 2015. © 2006 American Association for Cancer cancerres.aacrjournals.org Downloaded from