German Edition: DOI: 10.1002/ange.201503770 Ion–DNA Interactions International Edition: DOI: 10.1002/anie.201503770 Can A Denaturant Stabilize DNA? Pyridine Reverses DNA Denaturation in Acidic pH Guillem Portella, Montserrat Terrazas, Nfflria Villegas, Carlos Gonzµlez, and Modesto Orozco* Abstract: The stability of DNA is highly dependent on the properties of the surrounding solvent, such as ionic strength, pH, and the presence of denaturants and osmolytes. Addition of pyridine is known to unfold DNA by replacing p–p stacking interactions between bases, stabilizing conformations in which the nucleotides are solvent exposed. We show here experimen- tal and theoretical evidences that pyridine can change its role and in fact stabilize the DNA under acidic conditions. NMR spectroscopy and MD simulations demonstrate that the reversal in the denaturing role of pyridine is specific, and is related to its character as pseudo groove binder. The present study sheds light on the nature of DNA stability and on the relationship between DNA and solvent, with clear biotechno- logical implications. The biological role of DNA is intimately related to its structure and stability in water solution. Full dehydration of DNA or the substitution of water by a solvent of lower polarity results in large changes in the structure of DNA. [1] Variations in ionic strength of the solution yield remarkable structural plasticity, [2] and changes in the nature of counter- ions can even reverse the canonical rules of duplex DNA stability. [3] Some osmolytes such as urea, formamide, guani- dinium chloride, dimethylsulfoxide, and pyridine are known as chemical denaturants. [4] We recently used ms-long molec- ular dynamics (MD) simulations to demonstrate that the very strong denaturant properties of pyridine are related to its ability to capture microscopic unfolding events by stacking on open, solvent-exposed nucleobases. [5] Here we explore the denaturant properties of pyridine in the presence of another powerful denaturant parameter: the pH. In this work we evaluate whether the effect of these two denaturants is additive, cooperative, or anti-cooperative. We first explored the denaturing properties of pyridine at neutral pH for three DNA duplexes with different GC content (Table 1). Results shown in Figure 1 (A,B) and Table S1 (in the Supporting Information, SI) demonstrate that the addition of pyridine (Pyr) reduces the melting temperature of duplex DNA, even at low concentration (200 and 400 mm Pyr). At physiological ionic concentration (150 mm NaCl) the A·T pairings are more susceptible to the presence of Pyr than the G·C pairings, which is in good agreement with earlier experimental findings. [4] Increasing the ionic concentration from 150 mm up to 550 mm NaCl in the presence of 400 mm Pyr practically counteracts the effect of Pyr (Table S1), showing the protective action of Na + . Very interestingly, the addition of NaCl protects DNA from Pyr addition especially well in AT-rich sequences, thus suggesting that Na + is competing with Pyr for the same DNA regions. We next studied the effect of acidic pH on the stability of duplex DNA (Table S1). The same melting experiments done in the absence of Pyr at pH 4.2 and 3.8 revealed a dramatic decrease (up to 46 degrees) in the stability of the duplexes. The effect of pH is especially large as the percentage of GC increases ; suggesting that protonation of cytosines (pK a = 4.2) is the main mechanism for pH-dependent unfolding of DNA. To further support this hypothesis, we repeated the melting experiments substituting cytosine by 5-methylcytosine (MetC), a modification that is known to stabilize the duplex at neutral pH. [6] Indeed, we observed a rise in melting temperature for MetC-containing DNA, which, as expected, correlates with the percentage of the CG content (Table S2). As MetC is more easily protonated (pK a = 4.5) than cytosine, duplex-containing MetC are more pH-dependent than wild- type DNA. For example, the melting temperature of wild- type Seq. 3 decreases by about 46 degrees when moving from Table 1: DNA sequences used in this work and their percentage of GC content. [a] Sequence (GC content) Seq. 1 d(TATGTATATTTTGTAATTAA) (10 %) Seq. 2 d(CGTTTCCTTTGTTCTGGA) (44 %) Seq. 3 d(GTCCACGCCCGGTGCGACGG) (80 %) [a] Sequences given from 5’ to 3’, only the Watson strand is reported, the second strand is complementary in sequence. [*] Dr. G. Portella, [+] Dr. M. Terrazas, [+] Dr. N. Villegas, Prof. Dr. M. Orozco Institute for Research in Biomedicine (IRB Barcelona) Joint BSC-IRB Research Program in Computational Biology Barcelona (Spain) E-mail: modesto.orozco@irbbarcelona.org Prof. Dr. M. Orozco Department of Biochemistry and Molecular Biology University of Barcelona (Spain) Dr. G. Portella [+] Department of Chemistry University of Cambridge Cambridge CB2 1EW (UK) Dr. N. Villegas Barcelona Supercomputing Center Barcelona (Spain) Prof. Dr. C. Gonzµlez Instituto de Química Física Rocasolano, CSIC Madrid (Spain) [ + ] These authors contributed equally to this work. Supporting information for this article (including full details on the analysis of the thermal stability of DNA duplexes, NMR spectroscopy, and molecular dynamics simulations) is available on the WWW under http://dx.doi.org/10.1002/anie.201503770. A ngewandte Chemi e 1 Angew. Chem. Int. Ed. 2015, 54,1–5  2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim These are not the final page numbers! Ü Ü