Molecular Ecology Notes (2004) doi: 10.1111/j.1471-8286.2004.00637.x © 2004 Blackwell Publishing Ltd Blackwell Publishing, Ltd. PRIMER NOTE Isolation of 21 new polymorphic microsatellite loci in the phytopathogenic fungus Venturia inaequalis FABIEN GUÉRIN,* PIERRE FRANCK,† ANNE LOISEAU,‡ MARTINE DEVAUX* and BRUNO LE CAM* * UMR PaVé INRA-INH-Université d’Angers, B.P. 57, 42 rue Georges Morel, F49071 Beaucouzé CEDEX, France, † UMR 406 INRA- UAPV, Domaine de Saint-Paul, Site Agroparc, F85914, Avignon CEDEX 9, France, ‡ INRA, Centre de Biologie et de Gestion des Populations, Campus International de Baillarguet CS 30 016, F34988, Monferrier-sur-Lez CEDEX, France Abstract Twenty-one new polymorphic microsatellite markers were isolated in the phytopathogenic fungus Venturia inaequalis, the causal agent of apple scab. An enrichment protocol was used to isolate microsatellite loci and the level of polymorphism was assessed on 44 European isolates. All loci were polymorphic with an average of 9.1 alleles per locus (range 2 – 24). Tests of cross-species amplifications suggest that at least some of these microsatellites could be used in different species, mainly Spilocaea pyracanthae and S. eriobotryae. Keywords: apple, genetic diversity, Malus × domestica, Pyrus spp., simple sequence repeat, Venturia spp. Received 20 December 2003; revision accepted 13 February 2004 The haploid ascomycete Venturia inaequalis (Cke) (anamorph Spilocea pomi) is the causal agent of apple scab, an import- ant disease of apple which occurs in every country where the cultivated apple is grown (MacHardy 1996). Until now, the genetic structure of V. inaequalis populations has been studied using random amplified polymorphic DNA markers (Tenzer & Gessler 1997, 1999), amplified fragment length polymorphism (Guérin & Le Cam 2004) and with a low number of microsatellite loci (Tenzer et al . 1999; Guérin & Le Cam 2004). These studies revealed a high level of diversity in this heterothallic fungus mainly due to its repro- duction mode combining one sexual cycle each year followed by many vegetative cycles. Among the seven microsatellite loci currently published (Tenzer et al . 1999), only three showed a level of polymorphism high enough to be inform- ative in a V. inaequalis population. Hence, the development of more polymorphic markers was needed to allow more precise studies of the spatial and host-related structure of natural populations of V. inaequalis , especially at local geographical scales. We present here the isolation and characterization of 21 new polymorphic microsatellite loci in V. inaequalis . Genomic DNA of V. inaequalis was isolated from fungal cultures as described by Le Cam et al . (2001) and 7 μ g were digested with Rsa I restriction enzyme (Eurogentec). The 300 –1500-bp fraction of the digested DNA was selected on agarose gel, purified and then ligated to Rsa 21 and Rsa 25 linkers [ Rsa 21 (5 ′- 3 ′ ), CTCTTGCTTACGCGTGGACTA; Rsa 25 (5 ′- 3 ′ ), phosphate-TAGTCCACGCGTAAGCAAGAG]. Ligated fragments were subsequently amplified by poly- merase chain reaction (PCR) using only Rsa 21 linker as primer before enrichment of the bank for microsatellite motifs. The enrichment procedure followed the protocol of Kijas et al . (1994) based on streptavidin-coated magnetic beads (Magnesphere; Promega) using 5 ′ -biotinylated, 3 ′ -aminated (TC) 10 and (TG) 10 oligonucleotides as probes. The enriched single-stranded DNA fragments were amplified using Rsa 21 linker as primer to recover double- stranded DNA. The PCR products were purified and ligated into pGEM-T Easy vector (Promega) and the plas- mid transformed into Escherichia coli supercompetent cells (XL1 blue; Stratagene). In total, 1540 recombinant clones (enrichment for TC microsatellites) and 1034 recombinant clones (enrichment for TG microsatellites) were picked, arranged on a matrix and cultured on solid LB/ampicillin media at 37 ° C overnight. Colonies were then transferred on Hybond-N nylon membranes (Amersham) and screened by hybridization using (TC) 10 and (TG) 10 dioxigenine- labelled probes (Estoup et al. 1993; detailed protocol available at http://www.inapg.inra.fr/dsa/microsat/microsat.htm). Correspondence: Fabien Guérin. Fax: (+ 33) 2 41 22 57 05; E-mail: fguerin@angers.inra.fr