BRIEF REPORTS 325 6. Hsu, L. C., and Chang, W.-C. (1991). Cloning and characteriza- tion of a new functional human aldehyde dehydrogenase gene. J. Biol. Chem. 266: 12257-12265. 7. Hsu, L. C., Chang, W-C., Shibuya, A., and Yoshida, A. (1992). Human stomach aldehyde dehydrogenase cDNA and genomic cloning, primary structure, and expression in Escherichia coli. J. Biol. Chem. 26'/: 3030-3037. 8. Lindahl, R., and Peterson, D. R. (1991). Lipid aldehyde oxida- tion as a physiologicalrole for class 3 aldehyde dehydrogenases. Biochem. Pharmacol. 41: 1583-1587. 9. Mackerell, A. D., Jr., Blatter, E. E., and Pietruszko, R. (1986). Human aldehyde dehydrogenase: Kinetic identification of the isozyme for which biogenic aldehydes and acetaldehydes com- pete. Alcohol Clin. Exp. Res. 10: 266-270. 10. Martin, K. O., and Monder, C. (1978). Oxidation of steroids with the 20~-hydroxy-21-oxo side chain to 20~-hydroxy-21-oicacid by horse liver aldehyde dehydrogenases. J. Steroid Biochem. 9: 1233-1240. 11. Monder, C., Purkaystha, A. R., and Pietruszko, R. (1982). Oxi- dation of the 17-aldol (20/~-hydroxy-21-aldehyde) intermediate of corticosteroid metabolism to hydroxy acids by homogeneous human liver aldehyde dehydrogenase. J. Steroid Biochem. 17: 41-49. 12. Pietruszko, R. (1983). Aldehyde dehydrogenase isozymes. Iso- zymes: Current Topics Biol. Med. Res. 8: 195-217. 13. Santisteban, I., Povey, S., West, L. F., Parrington, J. M., and Hopkinson, D. A. (1985). Chromosome assignment, biochemical and immunological studies on a human aldehyde dehydroge- nase, ALDH3. Ann. Hum. Genet. 49: 87-100. 14. Spritz, R. A., Strunk, K. M., Hsieh, C-L., Sekhon, G. S., and Francke, U. {1991). Homozygous tyrosinase gene mutation in an American Black with tyrosinase-negative (type 1A) oculocu- taneous albinism. Am. J. Hum. Genet. 48: 318-324. 15. Tipton, K. F. (1985). Aldehyde dehydrogenases. Progr. Clin. Biol. Res. 1'/4: 3-13. 16. Tipton,K. F., Houslay, M. D., and Turner, A. J. (1977). Metabo- lism of aldehydes in brain. Essays Neurochem. Pharmacol. 1: 103-138. 17. Yoshida,A., Hsu, L. C., and Yasunami, M. (1991). Genetics of human alcohol-metabolizing enzymes. Progr. Nucleic Acid Res. Mol. Biol. 40: 255-287. Mapping the Human Corticotropin Releasing Hormone Binding Protein Gene (CRHBP) to the Long Arm of Chromosome 5 (Sq11.2-q13.3) Nicholas C. Vamvakopoulos, *,1 Theologia O. Sioutopoulou,t Scott A. Durkin,~ William C. Nierman,~ John J. Wasmuth,§ and John D. McPherson§ 1To whom correspondence should be addressed at the Department of Biology,University of Thessaly School of Medicine, 22 Papakyriazi Street, Larisa 412 22, Thessaly, Greece. Telephone: 30-41-259974. Fax: 30-41-255420. GENOMICS 25, 325-327 (1995) 0888-7543/95 $6.00 Copyright © 1995 by Academic Press, Inc. All rights of reproduction in any form reserved. *Department of Biology, University of ThessalySchool of Medicine, Larisa 412 22, Greece,"tUniversity of Athens Medical School, Athens, Greece, ~Department of Molecular Biology, American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852-1176; and §National Human Genome Research Center, Department of Biological Chemistry, College of Medicine, University of California, Irvine, California 92717 Received June30, 1994;revised October7, 1994 Unexpected stimulation or stress activates the heat shock protein (hsp) system at the cellular level and the hypotha- lamic-pituitary-adrenal (HPA) axis at the level of the whole organism (13). At the molecular level, these two systems com- municate through the functional interaction between hsp90 and glucocorticoid receptor (GR) (9). The corticotropin releas- ing hormone (CRH) system regulates the mammalian stress response by coordinating the activity of the HPA axis (7). It consists of the 41-amino-acid-long principal hypothalamic secretagogue for pituitary adrenocorticotropic hormone (ACTH), CRH (12), its receptor (CRHR) (1, 18), and its bind- ing protein (CRHBP) (10). Because of its central role in the coordination of stress response and whole body homeostasis, the CRH system has been implicated in the pathogenesis of neuroendocrine and psychiatric disease (15). Several genes of central importance to the stress system have been assigned to human chromosomes, including the expressed intron-containing forms of hsp90a (HSPCAL4, 14q32) and hsp90~ (HSPCB, 6p21) (2, 14), GR (GRL, 5q31) (8), proopiomelanocortin (POMC, 2p25) (8), ACTH receptor (ACTHR/MC2R, 18p 11.21-pter) (16), and arginine vasopres- sin/oxytocin (ARVP/OXT, 20pter-pl2.21) (8). The human CRH and CRHR genes have already been assigned to 8q13 (8) and 17ql2-qter (17), respectively. We report here the assignment of human CRHBP gene to 5qll.2-q13.3 by poly- merase chain reaction (PCR) amplification of CRHBP-specific DNA sequences from well-characterized human-rodent so- matic cell hybrid DNAs. The CRHBP gene was assigned to human chromosome 5 by discordancy analysis (data not shown) of PCR amplification products from NIGMS mapping panels 1 and 2 DNA tem- plates (Coriell Institute for Medical Research, Camden, NJ), as previously described (15). The PCR primers (Pf, 5'-ATG- GCCATTGTGTATGATI~TGATGCAC, and Pr, 5'-GCCATG- TGTTCATTTACAGATTACAAAC) amplified a 169-bp-long fragment from the 3' untranslated region of the human CRHBP gene (10). Amplifications were performed in 25-#1 reactions containing 200 ng genomic DNA, 50 nmol of each primer, and 1.5 mM MgC12 using the Gene Amp kit (Perkin- Elmer Cetus) for 35 cycles (denaturation 94°C for 45 s, an- nealing at 65°C for 30 s, and extension at 72°C for 35 s). Prior to the first PCR cycle the DNA was heated at 94°C for 3 min and the last cycle was followed by a 72°C incubation for 10 min. Subsequently, we determined the location of the CRHBP gene within human chromosome 5 by PCR amplification of genomic DNA template from somatic cell hybrids that contain deletions of this chromosome. The results are shown in Fig. 1. All of the hybrid cell lines employed have been described previously (4). Amplification of the 169-bp DNA fragment was seen only in the cell lines that contained chromosome 5