HYPERINSULINISM OF INFANCY ASSOCIATED WITH A NOVEL SPLICE SITE MUTATION IN THE SCHAD GENE KHALID HUSSAIN, MD, PETER T. CLAYTON, MD, STEVE KRYWAWYCH,PHD, I LENIA CHATZIANDREOU,PHD, PHILLIPA MILLS,PHD, D. W. GINBEY, MD, ANS J. J. M. GEBOERS,PHD, RUUD BERGER,PHD, I NGE E. T. VAN DEN BERG,PHD, AND SIMON EATON,PHD Fatty acids play an important role in regulating insulin secretion, but the mechanisms are unclear. We report a case of a novel splice site mutation in the short-chain 3-hydroxyacyl-CoA dehydrogenase (SCHAD) gene associated with hyperinsulinism. This mutation resulted in a nearly complete absence of immunoreactive protein and a decrease in fibroblast SCHAD activity. (J Pediatr 2005;146:706-8) G lucose is the prime regulator of insulin secretion from b-cells. Fatty acids can increase insulin secretion in vivo and amplify glucose-induced insulin secretion in vitro. 1 Two major pathways are involved in regulating insulin secretion from b-cells. 2 The K ATP channel–dependent pathways involve the metabolism of glucose. The K ATP –independent pathway involves anaplerotic input into the tricarboxylic acid cycle with generation of citrate and increases in cytosolic malonyl-CoA. Increased concentration of extramitochondrial malonyl-CoA inhibits carnitine palmitoyltransferase I blocking the entry of long-chain acyl-CoA into the mitochondria. Accumulating long- chain acyl-CoA esters then act as effector molecules regulating the activity of enzymes and channels and augmenting glucose- induced insulin secretion from b-cells through intracellular metabolism and generation of lipid-derived molecules. 3 Short-chain L-3-hydroxyacyl-CoA dehydrogenase (SCHAD) is an intramitochondrial enzyme that catalyses the penultimate reaction in the b-oxidation of fatty acids, the NAD 1 -dependent dehydrogenation of 3-hydroxyacyl–CoA to the corresponding 3-Ketoacyl-CoA. 4 We recently described a novel cause of hyperinsulinism associated with a homozygous point mutation in the SCHAD gene. 5 We now report hyperinsulinism in a child with a novel splice site mutation in the SCHAD gene. METHODS Clinical Case History This child was born to consanguineous first cousin parents, with a birth weight of 3.1 kg. At 4 months of age he presented with hypoglycemia and seizures. Investigations showed an increased glucose clearance rate (7 mg/kg per minute) and a biochemical picture consistent with hyperinsulinemic hypo–fatty acidemic hypoketotic hypoglycemia. This patient responded to 5 mg/kg per day diazoxide and 7.5 mg/kg per day chlorothiazide. Measurement of 3-Hydroxyacyl-CoA Dehydrogenase Activity Short-, medium-, and long-chain 3-hydroxyacyl-CoA dehydrogenase activity was measured in fibroblasts as described previously. 6 The protein was normalized to supernatant protein rather than total cellular protein. Proteins were separated, electro- blotted overnight, and detected by Western blotting as described previously. 6 Exon-specific PCR amplification of SCHAD sequences was performed with the appropriate primer pair for each exon, as described in Reference 5. DNA from the patient, his parents, and a control subject were amplified by using forward primer 5#AGTGCTGCCGTTTTCTCCAT3# and reverse primer 5#GGTAACCGGCTCCTAATTTC3#, which introduce a From London Centre for Paediatric Endocrinology and Metabolism, Bio- chemistry, Endocrinology, and Metab- olism Unit, Institute of Child Health, University College London and Great Ormond Street Hospital for Children NHS Trust, London, United Kingdom; Bradford Hospitals NHS Trust, London, United Kingdom; and the Department for Metabolic and Endocrine Diseases, University Medical Centre of Utrecht, E Utrecht, The Netherlands. Supported by the NHS Executive R & D funding (Research at the Institute of Child Health and Great Ormond Street Hospital for Children NHS Trust). Submitted for publication Sep 23, 2004; revision received Dec 3, 2004; accepted Jan 14, 2005. Reprint requests: Dr K. Hussain, Unit of Biochemistry, Endocrinology, and Metabolism, Institute of Child Health, University College London, 30 Guil- ford St, London WC1N 1EH. 0022-3476/$ - see front matter Copyright ª 2005 Elsevier Inc. All rights reserved. 10.1016/j.jpeds.2005.01.032 SCHAD Short-chain 3-hydroxyacyl-CoA dehydrogenase 706