Gene Mapping Report
Cytogenet Cell Genet 92:353 (2001)
Assignment
1
of BCL2L11 to human chromosome
band 2p13 with somatic cell and radiation hybrids
S. Murray,
a,b
S. Halford,
a
N.D. Ebenezer,
a
C.Y. Gregory-Evans
c
and
S.S. Bhattacharya
a
a
Institute of Ophthalmology, UCL, London (UK);
b
Hellenic Pasteur Institute, Athens, Hellas (Greece);
c
Imperial College of Science, Technology and Medicine, London (UK)
1
To our knowledge this is the first time this gene has been mapped.
Supported by The Guide Dogs for the Blind (grant number: CJE/AK/ak/96-23).
Received 27 November 2000; manuscript accepted 19 December 2000.
Request reprints from Dr Samuel Murray, Hellenic Pasteur Institute,
127 vas Sophias Avenue, 11521 Athens (Greece);
telephone: (301) 6455071; fax (301) 6456547; email: smbhsam@ucl.ac.uk
ABC
Fax + 41 61 306 12 34
E-mail karger@karger.ch
www.karger.com
© 2001 S. Karger AG, Basel
0301–0171/01/0924–0353$17.50/0
Accessible online at:
www.karger.com/journals/ccg
Rationale and significance
The Bcl-2 family of proteins are central to development and
homeostasis, and alterations in the levels of various family
members have been linked to disease (Reed, 1998). BCL2L11
(apoptosis facilitator) a BH3 only containing Bcl-2 like protein
is a pro-apoptotic agonist (O’Conner et al., 1998), which is nor-
mally sequestered to the microtubular dynein motor complex
by interaction with dynein light-chain LC8 (Puthalakath et al.,
1999). It can be activated by growth factor withdrawal, Ca
2+
flux or microtubule perturbation (Bouillet et al., 1999). Intra-
cellular release of this molecule potentiates the dissociation of
Bcl-2 like proteins thereby tipping the balance towards an
apoptotic fate. Human BCL2L11 was mapped to chromosome
2 on a somatic cell hybrid panel, and its position refined to
band 2p13 using the Genebridge4 radiation hybrid panel.
Materials and methods
The Genebridge4 radiation hybrid panel (Gyapay et al., 1996) was
obtained from the UK Human Genome Mapping Project Resource Centre
(HGNW-RC). The NIGMS HGCR somatic cell hybrid mapping panel #2
(Dubois and Naylor, 1993) was obtained from Coriell Cell Repositories (New
Jersey, USA). These were screened using primers Bim125F and Bim359R.
Amplified samples were run on a 2 % agarose gel with negative controls. Scor-
ing of cell line DNA amplification was made blind to their chromosomal
content. All PCR reactions were performed in duplicate.
Primer name Primer sequence
1. Bim125F GTAATCCTGAAGGCAATCACGGAG
2. Bim359R ATAGTGGTTGAAGGCCTGGCAA
Amplicon: Bim125F and Bim359R 257 bp
Conditions: 100 ng DNA, 1.5 mM primers, 1 mM dNTP’s, 1.5 mM
MgCl
2
, 1 × PCR buffer, 2.5 units Taq (BioTaq, Bioline UK); 94 ° C 30 s,
60 ° C 30 s, 72 ° C 30 s, 40 cycles
Results
Somatic cell hybrid mapping results
Primer pair Bim125F and Bim359R amplified DNA from
the Coriell panel corresponding to chromosome 2 (cell line
GM/NA10826B), with all other DNA’s being negative.
Radiation hybrid mapping results
The localisation of BCL2L11 on chromosome 2 was refined
using the Genebridge4 panel. Primers Bim125F and Bim359R
were scored as follows: 02002 02000 22000 01000 00010 00001
00000 01010 00022 00000 00001 01200 00100 12102 00201
00002 00000 00010 101. Analysis by RHMAPPER WI/MIT
www site (http://carbon.wi.mit.edu:8000/cgi-bin/contig/
rhmapper.pl) mapped BCL2L11 to a region 6.19 cR from
AFM151XD12 and 2.74 cR from WI-6701 with a LOD 12,
placing it at 2p13.
References
Bouillet P, Metcalf D, Huang DCS, Tarlinton DM, Kay TWH, Kontgen F, Adams
JM, Strasser A: Proapoptotic Bcl-2 relative Bim required for certain apoptotic
responses, leukocyte homeostasis and to preclude autoimmunity. Science
286:1735–1738 (1999).
Dubois BL, Naylor SL: Characterization of NIGMS human/rodent somatic cell
hybrid mapping panel 2 by PCR. Genomics 16:315–319 (1993).
Gyapay G, Schmitt K, Fizames C, Jones H, Vega-Czamy N, Spillett D, Muselet D,
Prud’Homme JF, Dib C, Auffray C, Morissette J, Weissenbach J, Goodfellow
PN: A radiation hybrid map of the human genome. Hum molec Genet 5:339–346
(1996).
O’Conner L, Strasser A, O’Reilly LA, Hausmann G, Adams JM, Cory S, Huang DCS:
Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J
17:384–395 (1998).
Puthalakath H, Huang DCS, O’Reilly LA, King SM, Strasser A: The proapoptotic
activity of the Bcl-2 family member Bim is regulated by interaction with the
dynein motor complex. Mol Cell 3:287–396 (1999).
Reed JC: Bcl-2 family proteins. Oncogene 17:3225–3236 (1998).
Downloaded by:
University of British Columbia
137.82.183.70 - 2/18/2014 6:56:21 PM