Gene Mapping Report Cytogenet Cell Genet 92:353 (2001) Assignment 1 of BCL2L11 to human chromosome band 2p13 with somatic cell and radiation hybrids S. Murray, a,b S. Halford, a N.D. Ebenezer, a C.Y. Gregory-Evans c and S.S. Bhattacharya a a Institute of Ophthalmology, UCL, London (UK); b Hellenic Pasteur Institute, Athens, Hellas (Greece); c Imperial College of Science, Technology and Medicine, London (UK) 1 To our knowledge this is the first time this gene has been mapped. Supported by The Guide Dogs for the Blind (grant number: CJE/AK/ak/96-23). Received 27 November 2000; manuscript accepted 19 December 2000. Request reprints from Dr Samuel Murray, Hellenic Pasteur Institute, 127 vas Sophias Avenue, 11521 Athens (Greece); telephone: (301) 6455071; fax (301) 6456547; email: smbhsam@ucl.ac.uk ABC Fax + 41 61 306 12 34 E-mail karger@karger.ch www.karger.com © 2001 S. Karger AG, Basel 0301–0171/01/0924–0353$17.50/0 Accessible online at: www.karger.com/journals/ccg Rationale and significance The Bcl-2 family of proteins are central to development and homeostasis, and alterations in the levels of various family members have been linked to disease (Reed, 1998). BCL2L11 (apoptosis facilitator) a BH3 only containing Bcl-2 like protein is a pro-apoptotic agonist (O’Conner et al., 1998), which is nor- mally sequestered to the microtubular dynein motor complex by interaction with dynein light-chain LC8 (Puthalakath et al., 1999). It can be activated by growth factor withdrawal, Ca 2+ flux or microtubule perturbation (Bouillet et al., 1999). Intra- cellular release of this molecule potentiates the dissociation of Bcl-2 like proteins thereby tipping the balance towards an apoptotic fate. Human BCL2L11 was mapped to chromosome 2 on a somatic cell hybrid panel, and its position refined to band 2p13 using the Genebridge4 radiation hybrid panel. Materials and methods The Genebridge4 radiation hybrid panel (Gyapay et al., 1996) was obtained from the UK Human Genome Mapping Project Resource Centre (HGNW-RC). The NIGMS HGCR somatic cell hybrid mapping panel #2 (Dubois and Naylor, 1993) was obtained from Coriell Cell Repositories (New Jersey, USA). These were screened using primers Bim125F and Bim359R. Amplified samples were run on a 2 % agarose gel with negative controls. Scor- ing of cell line DNA amplification was made blind to their chromosomal content. All PCR reactions were performed in duplicate. Primer name Primer sequence 1. Bim125F GTAATCCTGAAGGCAATCACGGAG 2. Bim359R ATAGTGGTTGAAGGCCTGGCAA Amplicon: Bim125F and Bim359R 257 bp Conditions: 100 ng DNA, 1.5 mM primers, 1 mM dNTP’s, 1.5 mM MgCl 2 , 1 × PCR buffer, 2.5 units Taq (BioTaq, Bioline UK); 94 ° C 30 s, 60 ° C 30 s, 72 ° C 30 s, 40 cycles Results Somatic cell hybrid mapping results Primer pair Bim125F and Bim359R amplified DNA from the Coriell panel corresponding to chromosome 2 (cell line GM/NA10826B), with all other DNA’s being negative. Radiation hybrid mapping results The localisation of BCL2L11 on chromosome 2 was refined using the Genebridge4 panel. Primers Bim125F and Bim359R were scored as follows: 02002 02000 22000 01000 00010 00001 00000 01010 00022 00000 00001 01200 00100 12102 00201 00002 00000 00010 101. Analysis by RHMAPPER WI/MIT www site (http://carbon.wi.mit.edu:8000/cgi-bin/contig/ rhmapper.pl) mapped BCL2L11 to a region 6.19 cR from AFM151XD12 and 2.74 cR from WI-6701 with a LOD 12, placing it at 2p13. References Bouillet P, Metcalf D, Huang DCS, Tarlinton DM, Kay TWH, Kontgen F, Adams JM, Strasser A: Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis and to preclude autoimmunity. Science 286:1735–1738 (1999). Dubois BL, Naylor SL: Characterization of NIGMS human/rodent somatic cell hybrid mapping panel 2 by PCR. Genomics 16:315–319 (1993). Gyapay G, Schmitt K, Fizames C, Jones H, Vega-Czamy N, Spillett D, Muselet D, Prud’Homme JF, Dib C, Auffray C, Morissette J, Weissenbach J, Goodfellow PN: A radiation hybrid map of the human genome. Hum molec Genet 5:339–346 (1996). O’Conner L, Strasser A, O’Reilly LA, Hausmann G, Adams JM, Cory S, Huang DCS: Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J 17:384–395 (1998). Puthalakath H, Huang DCS, O’Reilly LA, King SM, Strasser A: The proapoptotic activity of the Bcl-2 family member Bim is regulated by interaction with the dynein motor complex. Mol Cell 3:287–396 (1999). Reed JC: Bcl-2 family proteins. Oncogene 17:3225–3236 (1998). Downloaded by: University of British Columbia 137.82.183.70 - 2/18/2014 6:56:21 PM