Electrochemical genosensor based on three-dimensional DNA polymer brushes monolayers Olivier Y.F. Henry a, ⁎, Sinead Kirwan a , Ahmed Mehdi Debela a , Ciara K. O'Sullivan a, b, ⁎⁎ a Nanobiotechnology and Bioanalysis Group, Departament d'Enginyeria Química, Universitat Rovira i Virgili, Tarragona 43007, Spain b Institució Catalana de Recerca i Estudis Avançats, Passeig Lluís Companys 23, 08010 Barcelona, Spain abstract article info Article history: Received 11 July 2011 Received in revised form 2 September 2011 Accepted 12 September 2011 Available online 17 September 2011 Keywords: Polymer brushes Atom transfer polymerisation DNA A new approach to the three dimensional integration of short DNA strands at gold electrode surfaces via the in situ formation of DNA-acrylamide conjugates is presented. Surface initiated atom transfer radical polymer- isation was employed to grow acrylamide brushes co-polymerised in the presence of acrylamide modified DNA probes. This strategy was demonstrated for the realisation of biofunctionalised thin polymer films capa- ble of binding its complementary 105-base DNA amplicon. The synthesised brushes were characterised using atomic force microscopy, attenuated total reflectance spectroscopy and electrochemical impedance spectros- copy. Once characterised, the polymer brushes were applied to the quantitative detection of target DNA using an enzyme labelled reporter DNA probe in a sandwich-type format. © 2011 Elsevier B.V. All rights reserved. 1. Introduction The requirements for evermore sensitive and rapid DNA testing continue to grow, with particular emphasis on point-of-care applica- tions (POC), which demands efficient systems capable of rapidly delivering genomic information [1]. To that end, short DNA capture probes are typically immobilised onto surfaces to create low-density DNA arrays. However, surface hybridisation is an unfavourable pro- cess governed by the random Brownian motion of DNA strands to the surface, and through the DNA probe layer [2–5]. Several approaches have been proposed to reduce surface hybridisation time by enhancing diffusion by means of elegant microfluidic strate- gies [6–9] or a careful design of the immobilised DNA layer [10–12]. The possibility to engineer novel materials, such as DNA-polymer conjugates, providing a solution-like environment has also been pro- posed [13–17]. Nonetheless, these materials have been limited to the development of optical detection systems. To be applied to electro- chemical techniques, which are more suited for POC applications, the polymer morphology needs to be carefully controlled in order to prevent insulating the electrode surface. In that respect, polymer brushes represent an attractive possibility to engineer surface- tethered polymer hybrids, the length and density of which can be finely tuned [18–20]. Towards that goal we report the preparation of poly(acrylamide-b-DNA) combed brushes onto gold electrodes synthesised via surface initiated atom transfer radical polymerisation (SI-ATRP) for the electrochemical detection of the breast cancer related marker Exon16. The realised sensor exhibited an excellent sensitivity of 23.5 nA nM -1 and a limit of detection of 2.67 nM. The polymer brush prevented any non-specific binding of the enzyme labelled reporter probe and no cross-reactivity was observed with a non-related DNA se- quence (Lymphotoxin α). 2. Experimental 2.1. Materials All chemicals were purchased from Sigma Aldrich (Spain). Ultrapure water was obtained from a Millipore purification system (Millipore, Spain). Acrydite TM modified DNA sequences were obtained from IDT Ltd (Belgium). Unmodified and horseradish per- oxidase (HRP) labelled sequences were obtained from Biomers GmbH (Germany). Acrydite™ Exon16:5′-Acrydite- AGGGTCATCAGA GAAGAGG-3′; Exon16 perfect match:5′-CCTCTTCTCTGATGACCCT-3′; Exon16 full sequence: 5′-GGGTTCCCTAAGGGTTGGACCCTTACCTGG AATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCGGGATCTCT AGATTGGATCTTGCTGGCGCGTCC-3′;Lymphotoxin-α (LTA) full sequence: 5′GGGTTCCCTAAGGGTTGGACTTCTCCCCATGACACCACCTGAACGTCTCTT- CCTCCCAAGGGTGTGTGGCACCAGGGATCTCTAGATTGGATCTTGCTG- GCGCGTCC-3′;HRP labelled reporter probe sequence:5′-HRP-(CH 2 ) 6 - GTCCAA CCCTTAGGGAACCC-3′, complementary to the underlined sequences of Exon16 and LTA full sequences. The SI-ATRP initiator bromo-isobutyrate undecyldisulfide was purchased from Assemblon Inc. (USA). The electrode array chip con- sisted of 16 square-shaped 1 mm 2 gold electrodes, a silver reference and gold counter electrode (IMM, Mainz, Germany) [21]. High purity Electrochemistry Communications 13 (2011) 1155–1158 ⁎ Corresponding author. ⁎⁎ Correspondence to: C.K. O'Sullivan, Nanobiotechnology and Bioanalysis Group, Departament d'Enginyeria Química, Universitat Rovira i Virgili, Tarragona 43007, Spain. E-mail address: olivier.henry@urv.cat (O.Y.F. Henry). 1388-2481/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.elecom.2011.09.010 Contents lists available at SciVerse ScienceDirect Electrochemistry Communications journal homepage: www.elsevier.com/locate/elecom