Immunogenetics (1996) 43: 167-168 © Springer-Verlag 1996
SEQUENCE REGISTER
Sven Thirion • Kris Motmans • Harie Heyligen
Jef Raus • Caroline Vandevyver
PCR cloning and sequencing of a CD3-specific monoclonal antibody
Received: 1 September 1995 / Revised: 28 September 1995
Despite the fact that T cells are the main effectors against
tumor cells and several kinds of tumor cells express anti-
gens recognized by T cells (Van den Eynde et al. 1991; Van
der Bruggen et al. 1991), the immune response remains
very weak. Therefore, the design of an effective strategy to
enhance tumor-specific T-cell immunity would be helpful.
In this regard, antibodies could be a promising tool for
biotherapy. Moreover, antibodies against CD3 or CD28 can
be used to activate the costimulation pathway, which is
essential for an efficient in vivo tumor-specific T-cell
response (Chen et al. 1992; Townsend et al. 1993), since
stimulation through the T-cell receptor alone has been
reported to result in T-cell anergy or inactivation (Harding
et al. 1992). Here we describe the isolation and sequencing
of CD3-specific antibody genes in our efforts to construct
small single-chain antibody derivatives.
CD3-specific monoclonal antibodies were obtained by
fusing spleen cells from immunized mice with SP2/0
myeloma cells. One of the hybridomas (LY17.2G3) pro-
duces an antibody with a high affinity and specificity for
the Mr 22000 CD3 molecule (Heyligen 1993). This anti-
body has already been successfully used to activate
T lymphocytes (Bos et al. 1990). Starting from total
RNA, extracted from the anti-CD3-producing hybridoma
LY17.2G3, cDNA was prepared using random hexanucleo-
tide and oligo-dT primers. The heavy c~CD3 variable chain
was obtained by means of a polymerase chain reaction
(PCR) with the MH-7-CONST and MH-SP-ALT.2 primers
[which bind in the beginning of the constant and in the
leader area, respectively (Colama et al. 1991)] followed by
a nested PCR with the VH1 primers (Fig. 1). The variable
light chain gene segment was isolated using the mouse
immunoglobulin(Ig)-specific primers VkL (Orlandi et al.
1989). The mouse Ig-specific primers bind in framework
1 (VH 1-back and VkL-back) and 4 (VH1- for and VkL-for).
The czCD3 VK- and ¢xCD3 Vn-fragments were cloned into
the pCRII-vector (Invitrogen, San Diego, CA) taking ad-
vantage of the Taq polymerase to create 3'A-overhangs.
The c~CD3 VK- and czCD3 VH-fragments were recloned into,
S. Thirion (~) • K. Motmans • H. Heyligen • J. Raus • C. Vandevyver
Dr. L. Willems-Instituut, Universitaire Campus, Gebouw A,
B-3590 Diepenbeek, Belgium
K. Motmans • J. Raus
Limburgs Universitair Centrum, Universitaire Campus,
B-3590 Diepenbeek, Belgium
MH-~'-CONST : 5'-d(AYCTCCACACACAGGRRCCAGTGGATAGAC)-3'
MH-SP-ALT.2 : 5'-d(ATGRAATGSASCTGGGTYWTYCTCT)-3'
VHl-for
V H 1-back
VkL-for
VkL-back
: 5'-d(TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC)-3'
BstElI
: 5'-d(AGGTSMARCTGCAGSAGTCA)- 3'
PstI
: 5'-d(GTTAGATCTCCAGCTTGGTCCC)-3'
BgllI
: 5'-d(GACATTCAGCTGACCCAGTCTCCA)-3 '
PvulI
Fig. 1 Primers used for PCR-amplification. [(M = A or C, R = A or G,
S = C or G, W = A or T, Y = T or C) (Colama et al. 1991; Orlandi et aI.
1989)]
respectively, pEG VK- and pEM VH-vectors (Orlandi et al.
1989), using the restriction sites generated by the primers.
These vectors carry an expression cassette containing the
human variable leader and promoter sequences. Sequence
reactions were performed in two directions using the
Sanger dideoxy chain termination method (Sanger et al.
1975). Several clones were sequenced and compared to
overcome Taq polymerase errors. The resulting sequences
were classified (Kabat et al. 1991): the heavy chain variable
region (~xCD3 VH) is a II(B) type, the light chain variable
region ((zCD3 VK) is a VK-vr light chain (Fig. 2).
The deduced amino acid sequences were compared with
other known CD3-specific sequences (Parren et al. 1991;
Hayden et al. 1994). The CDR-identity was very low,
between 27%-36% for the heavy and 44%-69% for the
light chain (Fig. 3). Further similarity searches led to a
mouse/human chimeric antibody with a specificity for the
human c¢/[3 T-cell receptor (Shearman et al. 1991), which
showed high similarity to the c~CD3-antibody. The antibod-
ies differ in only a few amino acids (6 for the heavy and 3
for the light chain CDRs).
The obtained czCD3 VH and VK genes will be used to
design a CD3-specific single chain antibody derivative. We
expect that, because of size reduction by approximately
50%, these derivatives will be less immunogenic and will
show greater tumor infiltrating capacities.
Acknowledgments The authors thank Dr. G. Froyen for his kind help
with the Kabat classification. This work was supported by the "Bel-
gische Kankerliga" (Fellowship S. Thirion), the "Nationaal Fonds voor
Wetenschappelijk Onderzoek" (Fellowship K. Motmans), the "Lira-
burgs Kankerfonds", and the "Limburgs Universitair Centrum".