International Journal of Biological Macromolecules 48 (2011) 392–397 Contents lists available at ScienceDirect International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac Biophysical characterization of DNA and RNA aptamer interactions with hen egg lysozyme Ajish S.R. Potty a,1 , Katerina Kourentzi a , Han Fang b , Peter Schuck c , Richard C. Willson a,∗ a Department of Chemical & Biomolecular Engineering, University of Houston, 4800 Calhoun Rd, Houston, TX 77204-4004, USA b Department of Chemistry, University of Houston, Houston, TX 77204-5003, USA c Laboratory of Cellular Imaging and Macromolecular Biophysics, NIBIB, National Institute of Health, Bethesda, MD 20893-5766, USA article info Article history: Received 23 July 2010 Received in revised form 3 December 2010 Accepted 8 December 2010 Available online 16 December 2010 Keywords: Aptamers Hen egg white lysozyme Fluorescence anisotropy Isothermal titration calorimetry abstract This work characterized the binding of an RNA aptamer recognizing hen egg white lysozyme, as well as a literature-reported single-stranded DNA analog of sequence identical to the original RNA aptamer, using fluorescence anisotropy, isothermal titration calorimetry (ITC) and analytical ultracentrifugation. The polyanionic DNA aptamer analog is selective for lysozyme even over cationic cytochrome c and has been reported to be successfully used in biosensing applications. The association however, is predomi- nantly of electrostatic character, strongly salt-sensitive and entropically-driven, in contrast to previously described enthalpically-driven antibody–lysozyme and DNA aptamer–VEGF interactions. With a moder- ate selectivity for their target, high salt-sensitivity along with fast association and dissociation behavior, these molecules might serve as pseudo-affinity ligands for biomolecular separations. © 2011 Elsevier B.V. All rights reserved. 1. Introduction Aptamers are RNA or DNA molecules selected for binding to spe- cific targets, most commonly using in vitro evolution by iterative binding, elution and PCR amplification by SELEX (Systematic Evolu- tion of Ligands by EXponential enrichment) [1,2]. Aptamer affinity and selectivity are primarily governed by selection stringency, length of the aptamer, sequence and thermodynamic stability of its structure, with most characterized aptamers showing at least one stem-loop structure. While both RNA and DNA aptamers are widely reported, DNA lacks the 2 ′ hydroxyl functionality, reducing opportunities for internal and intermolecular hydrogen bonding. For example, Ellington and Szostak [3] have shown that RNAs of identical sequence as DNA aptamers to reactive green 19 do not recognize the target molecule, illustrating that RNAs and DNAs of identical sequence can behave very differently. Hen egg white lysozyme has long been a prominent model sys- tem for systematically studying protein–protein interactions. The availability of high-resolution crystal structures of lysozyme both free and complexed with various antibodies (reviewed in [4]) has paved the way for extensive experimental and theoretical investi- gations by several groups, including ours [5–9]. ∗ Corresponding author. Tel.: +1 713 743 4308; fax: +1 713 743 4323. E-mail address: willson@uh.edu (R.C. Willson). 1 Current Address: Millipore Corporation, Bedford, MA 01730, USA. It was recently reported that, interestingly, DNA of sequence identical to that of a SELEX-selected anti lysozyme RNA aptamer was successfully used to detect lysozyme in an electrochemical biosensor by Kawde et al. [10]. The same aptamer analog also was successfully used by Cheng et al. for voltammetric detection of lysozyme [11]. Kawde et al. were able to achieve electro- chemical detection of 7 nM lysozyme in a mixture containing an excess of competitor proteins and amino acids [10]. In this work, we attempt to understand this reported unexpected speci- ficity of the DNA aptamer analog by studying the interaction of lysozyme with an RNA aptamer and various DNA analogs as a func- tion of salt concentration, temperature, and pH using fluorescence anisotropy, isothermal titration calorimetry (ITC), and analytical ultracentrifugation. Comparisons are made to our previous studies of aptamer–VEGF [12] and antibody–lysozyme association [5–7]. 2. Materials and methods 2.1. Materials The 30-nucleotide anti-lysozyme RNA aptamer (5 ′ -GGUUGUG- AAGAUUGGGAGCGUCGUGGCUAC-3 ′ ) used in this study was cho- sen by deleting the flanking PCR target sequences from an aptamer reported by Cox and Ellington [13] and Kirby et al. [14]. Oligonu- cleotides a1, a2, and a3 are DNA analogs of RNA aptamers reported by Kirby et al. [14], but with 12 nucleotides of the 5 ′ PCR target sequence, and none of the 3 ′ PCR target sequence, with sequences: “a1” : 5 ′ - ATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACTT - 0141-8130/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.ijbiomac.2010.12.007