Myoneurin, a Novel Member of the BTB/POZ–Zinc Finger Family Highly Expressed in Human Muscle Patrick M. Alliel,* ,1 Nadia Seddiqi,† ,2 Danie `le Goudou,* Carmen Cifuentes-Diaz,* Norma Romero,‡ Elena Velasco,§ Franc ¸ois Rieger,* and Jean-Pierre Pe ´rin* *Institut National de la Sante ´ et de la Recherche Me ´dicale, U488, Ba ˆ timent Gregory Pincus, 80 rue du Ge ´ne ´ral Leclerc, Le Kremlin Bıˆce ˆtre cedex, 94276, France; †De ´partement de Biologie, Faculte ´ des Sciences Semlalia, Universite ´ Cadi Ayyad, Avenue Moulay Abdellah, Marrakech, Morocco; ‡Institut de Myologie, Ho ˆpital de la Salpe ´trie `re, Boulevard de l’Ho ˆpital, Paris, France; and §Escuela de Medecina J.M. Vargas U.C.V., Caracas, Venezuela Received May 8, 2000 Initially characterized as Drosophila developmental regulators, the BTB/POZ and zinc finger proteins (BTB/POZ-ZF) constitute a growing family of proteins with gene expression regulatory functions since they have been shown to be involved in both transcrip- tional activation and repression of various genes in a broad range of species, including mammals. Here we report the cloning of a novel human transcript, coding for a 68-kDa deduced BTB/POZ-ZF protein. This mole- cule, called myoneurin on the basis of its prevalent expression in the neuromuscular system, contains an amino-terminal BTB/POZ domain and eight tandemly repeated zinc-finger motifs of the C 2 H 2 type. The murine myoneurin, identified in the mouse embryo, is highly homologous to the human protein. © 2000 Academic Press Key Words: myoneurin; BTB/POZ; zinc finger; muscle. A novel class of structurally related zinc finger pro- teins (ZF), has been implicated in the control of a wide range of developmental events in Drosophila and mam- mals. They are characterized by classical C 2 H 2 zinc finger motifs, and a BTB/POZ protein–protein interac- tion domain (Zollman et al., 1994; Bardwell and Treis- man, 1994). Human BTB/POZ-ZF proteins can either activate or suppress transcription of distinct genes. BCL6/LAZ3 (Ye et al., 1993; Kerckaert et al., 1993) functions as a sequence specific transcriptional repres- sor (Chang et al., 1996). As PLZF (Chen et al., 1994), these molecules interact with a variety of corepressor proteins (Wong and Privalsky, 1998; Huynh and Bard- well, 1998). TRAX/RP58, a translin-associated protein (Aoki et al., 1997), mediates a sequence specific tran- scriptional repression (Aoki et al., 1998). ZID interacts with the CArG box region of the skeletal alpha-actin promoter (Bardwell and Treisman, 1994). Clone 18/ HKR3 regulates MHCII genes (Sugawara et al., 1994; Maris et al., 1996). HcKrox (Widom et al., 1997) is a transcriptional regulator of extracellular matrix genes. MIZ-1 has a potent growth arrest function related to its c-myc association ability (Peukert et al., 1997). ZF5 (Sugiura et al., 1997), another c-myc-binding protein (Numoto et al., 1993) exerts a growth suppressive ac- tivity in mouse cell lines (Numoto et al., 1995), and has been shown to be involved in both transcriptional ac- tivation and repression (Kaplan and Calame, 1997). Here we report a new transcript, conceptually coding for a protein with features of a BTB/POZ-ZF protein, and expressed in human skeletal muscle. The murine myoneurin has also been characterized by RT-PCR in 17-day embryo and in adult tissues and is highly ho- mologous to the human counterpart. METHODS cDNA cloning, RT-PCR, and sequencing. Two clones (clones 1 and 2) were isolated following a classical procedure (Huynh et al., 1985), during the screening of a human gt11 testicular library (Clontech Laboratories, Palo Alto, CA) with a polyclonal antiserum directed against an ovine testicular 68 kDa heparin-binding protein (a gift from Dr F. Bonnet) using goat anti-rabbit IgG-alkaline phos- phatase (1:7500 in TBS, 0.05% Tween 20) as a secondary antibody (Promega Corp., Madison, WI). Inserts were excised by EcoRI restric- tion digestion and subcloned in pGEM-4Z plasmid (Promega Corp.). Clone 3 was isolated during a subsequent screening of a gt10 human testicular library with a digoxygenin-11 dUTP (Boehringer- Mannheim GmbH, Mannheim, Germany) randomly labeled EcoRI/ XhoI restriction fragment covering the 5'-end of clone 1. A PCR amplification of the 5'-end region was carried out from the gt11 human testis cDNA library using a gt11 primer (Rgt11: 5' TTG- ACACCAGACCAACTGGTAATG 3' ) and antisense primers designed from the cDNA sequences from clones 1 and 3: HZ33, 5' CCACTTT- The GenBank Accession Number for the human myoneurin se- quence reported in this paper is AF148848. 1 To whom correspondence and reprint requests should be ad- dressed. Fax: (33) 1 45 21 19 40. E-mail: alliel@infobiogen.fr. 2 N.S. must be considered as an equal first author. Biochemical and Biophysical Research Communications 273, 385–391 (2000) doi:10.1006/bbrc.2000.2862, available online at http://www.idealibrary.com on 385 0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.