Plant Molecular Biology 19: 531-532, 1992. © 1992 Kluwer Academic Publishers. Printed in Belgium. Update section Sequence 531 Structure and sequence of a dehydrin-like gene in Arabidopsis thaliana Dean Rouse, Christopher A. Gehring and Roger W. Parish Department of Botany, La Trobe University, Bundoora, 3083, Australia Received 5 February 1992; accepted 12 February 1992 Key words:Arabidopsis thaliana, dehydrin nucleotide sequence Abscisic acid (ABA) and osmotic stress (possibly mediated by ABA) induce a large number of different genes [for review see 1]. Recently a number of cDNAs coding for dehydration- and ABA-induced proteins (dehydrins) have been characterized in barley (e.g. B18) and maize (M13) [2]. These dehydrins are similar to each other and to basic, glycine-rich rice RAB (Re- sponsive to ABA) proteins which are inducible (to different degrees) by abscisic acid as well as osmotic stress [3, 4]. Furthermore, some cotton LEA (late embryogenesis-abundant) proteins show considerable homology in their amino acid composition with the dehydrins and RAB pro- teins [5]. A tomato cDNA (TAS 14) inducible by salt stress and ABA also codes for a protein sim- ilar to the LEA (Dll) and the RAB (21, 16A) proteins [6]. An Arabidopsis genomic library was screened with a maize dehydrin cDNA and positive phage clones were identified at a frequency of approxi- Fig. 1. Nucleotide sequence and the deduced amino acid se- quence of a genomic clone containing a dehydrin-like gene. The intron is represented by lower-case letters and the aster- isk (*) indicates the stop codon. A putative polyadenylation signal is underlined. Two amino acid motifs common to de- hydrins are printed in italics. 1 ATTTGAT~T~T~T~TACTATA~ATTA~ATCCCTATCC_hA~GT 51 ~CGGTTCTATAAAAATACCATTCAAGAGCGTATACATCTTTATCCATCA i01 GTGTCTT~TTT~TCTATAGCTAAAAAAA~TTC~T~TAAAA~T 151 ATGGAGTCTTACCAAAAC~GTCC~AGCG~G~GACT~CC~GCT MESYQNQSGAQQTHQQL 201 ~ACCAATTT~AAATCCATTTCCAGC~C~CCGGAGCCTATC~C~ DQFGNPFPATTGAYGTA 251 CC~AGCTCCAGCCGTGGCTGAA~GT~TTT~GTGGCATGCTTCAC GAPAVAEGGGLSGMLH 301 CGTTCTC~GAGTAGCTCTAGCTCTAGCTCGgtatgcttctgttttacgca RSGSSSSSSS 351 attgcttttgcaatatttagtgtactctttctatatcaccaaatacaaga 401 agtttcatttaatttgacttcacctaactagaaaaaataaggaaaccata 451 ttttagatttaactaagaattacatattttttagaaattaccattttttg 501 tgttcaaatgataagttatttgtttgtaatttgaattatattcaaggtat 551 accatatattttaaattactaaataaaatatggaaagtgttgcaaataca 601 tgtagctttttaatttttctgacgattttcatgcatgaa~A~A~A~ EDDG 651 GACTA~T~AGGA~G~G~G~TAACGGAG~GA~AAA LGGRRRKKKGITEKIK 701 GAG~GCTGCCGGGTCAT~CGACTCC~CAAGACTTCTTC~TA~TTC EKLPGHHDSNKTSSLGS 751 TACA-ACGACGGCCTATGATACC~CCGTT~CCACGA~GAAAGG~ TTTAYDTGTVHHEKKGM 801 ~AT~A~GATCAAAGAG~GCTTCCG~T~T~TCATTAGTTT~T MEKIKEKLPGGHH* 851 TTT~TT~CT~TTT~TG~TCGTTACGCTTATGGTCGT~TGG 901 ~TAAATTATAAACCCTCTC The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X64199.