=robl. Inf. Parasit. Dis Vol. 32, 2004, 1 DEVELOPMENT OF AFLP AND RAPD METHODS FOR TYPING OF CLINICALLY SIGNIFICANT CANDIDA SPESICES T. Kantardiiev, V. Levterova, S. Panaiotov, I. Ivanov Department of Microbiology, NCIPD, Sofia, Bulgaria SUMMARY Two molecular epidemiology typing approaches RAPD (Random Amplified Polymorphic DNA) and AFLP (Amplified Fragment Length Polymorphism) have been applied for better evaluation of genetic diversity among Candida isolates with clinical significance. Main objectives of the study were to develop typing methodologies and to investigate the reproducibility, discriminatory power and typeability of each method applied. By using six short oligomer primers (10-15 mers) with arbitrary chosen sequences, distinc- tive and reproducible sets of RAPD products were observed. The AFLP technique was applied by amplifying specific Psf//SamH/re- striction fragments. With the applied typing methods it was found that the isolates obtained from a single person with chroniocal re- current vaginal candidosis, but isolated from different body sites show polymorphic fragments.We performed an attempt to study possible transmission of Candida strains in hospitalized HIV posi- tive patients. In conclusion, AFLP is a method with good reproduc- ibility, but laborious. RAPD needs strict performance criteria. INTRODUCTION During the last 10 years clinically significant Candida iso- lates are a serious medical problem, especially for mmunocompromised patients. The diseases caused by these microorganisms develop as viscerous (superficial) or systemic infections. Superficial infections are widely dis- tributed, but the scientific community could not answer to fundamental questions: L it is not clear to what extent vagi- nal candidosis is a sexually transmitted disease and //.there are no clear evidences whether strains colonizing the oral cavity and the colon lead to vaginal candidosis. The sec- ond group of infections are the systemic mycoses. The ge- netic homogeneity of commensal and infecting populations has not been adequately explored to make definitive con- clusions about how a clonal population evolves or is re- placed during continuous commensal carriage in the tran- sition from a commensal to pathogenic state or in recurrent infections. With the recent development of DNA fingerprint- ing techniques which allow assessment of strain related- ness at genetic level, many epidemiological questions can now be examined (1,2,3). Our goal with this study was to develop reliable molecular typing methods for clinically sig- nificant Candida species. Two molecular epidemiology typ- ing approaches - RAPD (AP-PCR) and AFLP have been applied for better evaluation of genetic diversity among Candida clinical isolates. We performed an attempt to dem- onstrate transmission of Candida strains in hospitalized patients and strain carriage. MATERIALS AND METHODS The investigated strains were: L Candida albicans isolated from vagina, oral cavity and anus from women with chronical recurrent vaginal candidosis, H. Candida rugosa strains isolated form a patient with pros- thetic valve endocarditis, Hi. Candida spp. isolated from patients with HIV infection. All strains were of Bulgarian ori- gin and biochemicaly identified by Vitek32. The RAPD typing has been performed with arbitrary chosen oligomer primers. UBC734-5'-GGAGAGGGAG -3-': (GACA) 4 - 5'- GACAGACAGACAGACA-3'; AP3- 5'-TCACGATGCA-3'; M13-5'-GAGGGTGGCGGTTCT-3'; CI-5'-ACGGGCCAGT-3'; AP12H-5'- CGGCCCCTGT-3'. For the 10-mer primers, UBC734, AP3, CI and AP12H the annealing temperature (Tm) was 37C. For the longer primers. (GACA) 4 and M13 the Tm was 45C. In our previous studies (4) we have described the develop- ment of an AFLP typing strategy based on DNA digestion with BamHI and Pstl restriction enzymes, ligation of appro- priate linkers (adaptors) to the restriction sites and PCR amplification of the polymorphic fragments with 32 P labeled BamHI primer. Briefly, for complete digestion with BamHI, about 3 ,ug DNA were placed in microcentrifuge tube with 5 11/ц1 BamHI (MBl Fermentas, Vilnus, Lithuania) and put at 37 °C for overnight incubation. Ethanol precipitation of DNA is performed for sample desalting and then the same pro- cedure is repeated with Pstl restriction enzyme (MBl Fermentas, Vilnus, Lithuania). The adaptors construction was performed second to manufacturer instructions (Invitrogen, Paisley, UK). 25 |il of each sample restricted with BamHIand Pstl was placed together with 10 |il BamHI adaptor, 10 |il Pstl adaptor, 5 ul ligation buffer and 2,5 U/jil T4 ligase (Amersham Bioscience, Piscataway NJ, USA) per sample in sterile microcentrifuge tube, vortexed shortly and left for 16 h at room temperature. Subsequent precipitation and washing of DNA was performed and the pellet dissolved in 50 ul of dH 2 0. The PCR was performed with two primers - BamP 19 and PstP 18 both incorporating A (adenine base) as selective nucleotide at 3' site (Fig. 1). The BamHI primer was 5 end-labeled with 32 P using T4 polynucleotide kinase (Amersham Bioscience, Piscataway NJ, USA). The label- ing reaction was performed in 50 ul volume containing: 5 |il Юх T4 PNK buffer (0,5 mM Tris-HCI pH 7.6,100 mM MgCI 2, 10 mM 2-mercaptoethanol), 10 ц1 [у- 32 Р]АТР 100 uCi (Amersham Bioscience, Buckinghamshire, UK), 90 pmol BamHI9 oligonucleotide, 3 U/ц! T4 PNK and sterile water to the final 50 ц1 reaction volume. The PCRs were performed with Ready-To-Go PCR beads (Amersham Bioscience, Piscataway NJ, USA). 5 ц1 template DNA, 10 pmol BamHI9 primer, 10 pmol PstP 18 primer and dH 2 0 up to 25 ul total reaction volume, were placed per tube. The PCR program was: 3 min at I. BamHl/Pstl restriction fragments ACCEPTED FOR PUBLICATION: 20.12.2003 ABBREVIATIONS USED IN THIS PAPER: RAPD - Random Amplified Polymorphic DNA: AFLP - Amplified Fragment Length Polymorphism CORRESPONDING AUTHOR: Todor Kantardjiev, MD, PhD National Center of Infectious and Parasitic Diseases Department of Microbiology 26. Yanko Sakasov Blvd. 1504 Sofia, Bulgaria. e-mail: kantardj@ncipd.netbg.com 5'-OATCC CTGCA-3' BamHI G G Pstl II. Ligation of adaptors BamHI adaptor GACCTGAITGGATGGATCC CTGCACGTCAGTGACACTGC ACTAACCTACCTAGG GACGTGCAGTCACTGTG Pstl adaptor III. PCR amplification with BamHI and Pstl primers BamHI P 32 labeled praimer 5 'P'GCCTGATTGGATGG ATCCa 5'-GACCTGAITGGATGGATCC —CTGCACGTCAGTGAC ACTGC-3' ACTAACCTACCTAGG GACGTGCAGTCACTGTG-5' aGACGTGCAGTC ACTGTG-5' Pst praimer Figure 1. AFLP design, restriction enzymes, nucleotide sequence of primers and adaptors. 35