1490 4. Watkins PB, Wrighton SA, Schuetz EG, Molowa DT, Guzelian PS. Identification of glucocorticoid-inducible cytochromes P-450 in the intestinal mucosa of rats and man. J Clin Invest 1987; 80: 1029-36. 5. Awni WM, Maloney JA. Optimized high-performance liquid chromatographic method for the analysis of cyclosporine and three of its metabolites in blood and unne. J Chromatogr 1988; 425: 233-36. 6. Aoyama T, Yamano S, Waxman DJ, et al. Cytochrome P-450 hPCN3, a novel cytochrome P-450 IIIA gene product that is differentially expressed in adult human liver. cDNA and deduced amino acid sequence and distinct specificity of cDNA expressed hPCN1 and hPCN3 for the metabolism of steroid hormones and cyclosporine. J Biol Chem 1989; 264: 10388-95. 7. Kolars JC, Stetson PL, Rush BD, et al. Cyclosporin A metabolism by P450IIIA in rat enterocytes: another determinant of oral bioavailability? Transplantation (in press). 8. Watkins PB. Role of cytochromes P450 in drug metabolism and hepatotoxicity. In: Kaplowitz N, ed. Seminars in liver diseases: recent advances in drug metabolism and hepatotoxicity, 1990: 235-50. 9. Gupta SK, Bakran A, Johnson RWG, Rowland M. Cyclosporin- erythromycin interaction in renal transplant patients. Br J Clin Pharmacol 1989; 27: 475-81. 10. Lucey MR, Kolars JC, Merion RM, Campbell DA, Aldrich M, Watkins PB. Cyclosporin toxicity at therapeutic blood levels and cytochrome P-450IIIA. Lancet 1990; 335: 11-15. ADDRESSES. Departments of Internal Medicine (J C Kolars, MD, P. B Watkins, MD) and Surgery (R M. Merion, MD), University of Michigan Medical Center, Ann Arbor, Michigan, and Drug Evaluation Unit (W M Awni, PhD), Hennepin County Medical Center, Minneapolis, Minnesota, USA. Correspondence to Dr Paul B Watkins, A711 9 University Hospital, Kughn Clinical Research Center, University of Michigan Hospital, Ann Arbor, Michigan 48109-0108, USA p53 germline mutations in Li-Fraumeni syndrome Germline mutations within a defined region of the p53 gene have recently been found in families with the Li-Fraumeni syndrome (LFS). In the present study this region of p53 was sequenced in affected individuals from 8 families with LFS. In only 2 of them were such mutations detected. Our findings suggest that the p53 mutation could be the primary lesion in some but not all families with LFS, and confirm that there is a "hot spot" for these mutations at the CpG dinucleotide moiety of codon 248. Assigning risks and counselling families on the basis of presence of p53 mutations should be approached with caution. The principal features of the Li-Fraumeni syndrome (LFS) include sarcomas in children and young adults and premenopausal breast cancer in their close relatives.’ 1 Germline mutations within a defined region of the p53 gene have recently been found in affected members and obligate carriers in families with LFS.2,3 These mutations were located in a stretch of 25 codons evolutionarily conserved.2 In sporadic tumours, this region of the gene often contains a INDIVIDUALS TESTED FROM EACH FAMILY ALL= acute lymphoblastic leukaemia, Mut248=mutation at codon 248 (full pedigrees of families tested are available from J M B Wt = wild type *Both patients mutation.4 The aim of our study was to see how common these mutations might be in such families. Families were eligible for the study if they fulfilled the criteria defmed by Li et al. Blood samples were taken from at least 1 affected member of 8 such families. DNA was extracted from blood or lymphoblastoid cell lines and from paraffin-embedded tissue.6,7 The conserved region in the 7th exon of p53 was amplified with the oligonucleotides GTTGTCTCCTAGGTGGCTC and TGGCAAGTGGCTCCTGACCT. Amplification was done in the presence of 1 ’5 /lffioljl MgClz, 50 /lffiolfl of each dNTP, and 1 umol/1 of each oligonucleotide for 30 to 35 cycles (94°C, 1 min; 58°C, 1 min; and 74°C, 1 min): the first cycle was preceded by a step at 95°C for 5 min after which 2 units of Taq polymerase were added. The final elongation step was extended by 5 min. The amplified product was phosphorylated with T4- polynucleotidekinase and ATP, filled in by means of Klenow enzyme (DNA polymerase 1, large fragment) and dNTP, ligated to SmaI-cut dephosphoryiated M13mpll (Amersham, UK), and cloned into Escherichia coli (strain XL1 Blue, Stratagene, La Jolla, USA) by standard methods. For at least 1 individual of each family a minimum of eight clones from at least two independent amplifications were sequenced with the ’Multiwell Sequencing System’ (Amersham). Direct sequencing’! was done to confirm the presence of mutations in other affected members of the families in which mutations were found. For family 8, material from 16 members (affected and unaffected) was available and a polymorphism in exon 4 of p53 was analysed.9 This polymorphism was detected by amplification with the pair of oligonucleotides CCCGGACGATATTGAACAATGGT and CCAGA- CGGAAACCGTAGCTGC before digestion of the amplified product with BstUI (Boehringer, Mannheim, Germany).