Brief Data Reports
Genetic mapping of the Na
+
-taurocholate
cotransporting polypeptide to mouse
Chromosome 12
R.M. Green,
1
M. Ananthanarayanan,
2
F.J. Suchy,
2
D.R. Beier
3
1
Division of Digestive and Liver Diseases, University of Illinois at
Chicago and Westside VAMC, 840 S. Wood St. M/C 787, Chicago,
Illinois 60612, USA
2
Department of Pediatrics, Mount Sinai School of Medicine, 1 Gustave
L. Levy Place, New York, New York 10029-6574, USA
3
Division of Genetics, Department of Medicine, Brigham & Women’s
Hospital, Harvard Medical School, 75 Francis St.,
Boston, Massachusetts 02115, USA
Received: 9 October 1997 / Accepted: 21 February 1998
Species: Mouse
Locus name: Na
+
-taurocholate cotransporting polypeptide
Locus symbol: SLC10A1
Map position: D12Mit3–2.2 ± 1.5 cM–D12Mit4–2.2 ± 1.5 cM–
Slc10a1, D12Mit5, D12Mit157–5.4 ± 2.4 cM–D12Mit6
Method of mapping: Linkage analysis was performed with the
BSS Backcross DNA Panel (The Jackson Laboratory, Bar Harbor,
Me.). The panel consists of 94 genotyped progeny of a (C57BL/6J
× SPRET/Ei) F
1
× SPRET/Ei backcross [1]. Linkage was estab-
lished with the Map Manager Classic program [2].
Database deposit information: Mouse Genomic Database acces-
sion number MGD-xxxx
Molecular reagents: Oligonucleotide primers were synthesized at
the Dana Farber Cancer Institute Molecular Biology Core Facility
(Boston, Mass.) Primers were designed corresponding to murine
Ntcp intron 2: 5'GCCCTAGGGGTTAGAGTTGAA 3' forward,
and 5'CCTTAGATGTGAAGGTTCTCA 3' reverse and were em-
ployed for PCR amplification of genomic DNA isolated from in-
bred strains.
Allele detection: A 178-bp PCR product polymorphism was de-
tected by single-strand conformation polymorphism analysis [3]
with mouse genomic DNA between C57BL/6 and SPRET/Ei. PCR
reactions performed on 94 progeny from an interspecific backcross
were subjected to single-strand conformation polymorphism
analysis and scored for the presence or absence of the C57BL/6
allele (see Fig. 1).
Previously identified homologs: The human SLC10A1 gene has
been mapped to Chromosome (Chr) 14 by Southern blot hybrid-
ization analysis of DNA with a panel of human/hamster somatic
cell hybrids [4]. The rat ortholog was mapped to Chr 6q24 with
FISH [5].
Discussion: Slc10a1 is a liver-specific gene that encodes for the
hepatocyte basolateral sodium-dependent co-transporter [6]. The
sodium-dependent taurocholate cotransporter is the major trans-
port protein responsible for hepatocyte sodium-dependent bile salt
uptake from the portal circulation, and gene expression is mark-
edly reduced in several experimental rodent models of cholestasis
[7–10]. Slc10a1 orthologs have been previously localized to hu-
man Chr 14 [4] and to rat Chr 6q24 [5]; our data are consistent
with these map positions.
The rat and hamster ileal sodium-dependent bile salt transporters
have been cloned and are homologous to Slc10a1 [11,12]; and the
human gene (SLC10A2) has been mapped to Chr 13q33 [13]. The
human organic anion transporting polypeptide gene, which en-
codes for a liver organic anion transporter that also transports bile
salts, is on Chr 12p12 [14] and also does not co-localize with
Slc10a1. Therefore, although there are homologous regions of
Slc10a1 and these other bile salt transporters, they map to differing
regions of the human or mouse genome. Although Slc10a1 maps
to a region of Chr 12 that has not been previously associated with
any murine models of cholestasis or liver pathology, the mapping
of murine Slc10a1 may prove useful in the future if murine models
of cholestatic diseases localize to this region.
References
1. Rowe LB, Nadeau JH, Turner R, Frankel WN, Letts VA et al. (1994)
Mamm Genome 5, 253–274
2. Manly KL (1993) Mamm Genome 4, 303–313. Map Manager Classic
is distributed via the World Wide Web. (URL: http://mcbio.med.
buffalo.edu/mapmgr.html/).
3. Beier DR, Dushkin H, Sussman DJ (1992) Proc Natl Acad Sci USA
89, 9102–9106
4. Hagenbuch B, Meier PJ (1994) J Clin Invest 93, 1326–1331
5. Cohn MA, Rounds DJ, Karpen SJ, Ananthanarayanan M, Suchy FJ
(1995) Mamm Genome 6, 60
6. Hagenbuch B, Steiger B, Foguet M, Lubbert H, Meier PJ (1991) Proc
Natl Acad Sci USA 88, 10629–10633
7. Green RM, Beier DB, Gollan JL (1996) Gastroenterology 111, 193–
198
8. Gartung C, Ananthanarayanan M, Rahman MA, Schuele S, Nundy S
et al. Gastroenterology 110, 199–209
9. Green RM, Gollan JL, Hagenbuch B, Meier PJ, Beier DR (1997) Am
J Physiol 273, G621–G627
10. Moseley RH, Wang W, Takeda H, Lown K, Shick L et al. (1996) Am
J Physiol 217, G137–146
11. Wong MH, Oelkers P, Craddock AL, Dawson PA (1994) J Biol Chem
269, 1340–1347
12. Schneider BL, Dawson PA, Christie DM, Hardiker W, Wong MH et
al. (1995) J Clin Invest 95, 745–754
13. Wong MH, Rao PN, Pettenati MJ, Dawson PA (1996) Genomics 33,
538–540
14. Kullak-Ublick GA, Beuers U, Meier PJ, Domdey H, Paumgartner G
(1996) J Hepatol 25, 985–987 Correspondence to: R.M. Green
Fig. 1. (A) Genotype data on mouse Chr 12 with a (C57BL/6J × SPRET/
Ei) F
1
× SPRET/Ei backcross and SSCP analysis. Black boxes represent
C57BL/6J alleles, and white boxes represent SPRET/Ei. (B) Linkage map
of mouse Chr 12 illustrating the position of Slc10a1 in relationship to
several previously mapped loci. The recombination frequencies (in cen-
timorgans) are shown on the left.
© Springer-Verlag New York Inc. 1998 Mammalian Genome 9, 598–600 (1998).
Incorporating Mouse Genome