Genetic Risk Factors in Japanese Alzheimer’s Disease Patients: 1-ACT, VLDLR, and ApoE H. YAMANAKA,* K. KAMIMURA,* H. TANAHASHI,* K. TAKAHASHI,* T. ASADA,† AND T. TABIRA 1 * *Division of Demyelinating Disease and Aging and †National Center Hospital for Nervous, Mental and Muscular Disorders, NCNP, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187, Japan YAMANAKA, H., K. KAMIMURA, H. TANAHASHI, K. TAKAHASHI, T. ASADA AND T. TABIRA. Genetic risk factors in Japanese Alzheimer’s disease patients: 1-ACT, VLDLR, and ApoE. NEUROBIOL AGING 19(1S) S43–S46, 1998.—We studied the polymorphism of 1-antichymotrypsin (ACT), very low density lipoprotein receptor (VLDLR) and apolipoprotein E (ApoE) genes in 200 control subjects and 65 patients with Alzheimer’s disease (AD) in Japanese. The subjects consisted of 30 patients with early onset familial Alzheimer’s disease (FAD), a patient with late onset FAD, 29 patients with an early onset isolated form of AD, and 5 patients with late onset AD. ApoE genotypes were significantly different between controls and FAD (p  0.0005) or AD (p  0.05), and patients carrying at least one ApoE 4 allele were found in 44% of FAD and 34.3% of AD; both were significantly different (p  0.001) from the controls (12.5%). ACT genotypes and allele frequencies were not different among these groups except for genotypes between ApoE 4 - FAD and ApoE 4 - controls (p = 0.019). There was a slight but significant increase of the 5 repeat allele of VLDLR in AD (p = 0.014), but the difference was rather diminished in the presence of an ApoE 4 allele. None of combinations of ACT and VLDLR genotypes in the presence or absence of an ApoE 4 allele gave significant difference. Thus, we conclude that among the reported genetic risk factors, ApoE 4 is the only definite risk factor for both FAD and AD, and the VLDLR polymorphism might be associated with AD cases in Japanese. © 1998 Elsevier Science Inc. Alzheimer’s disease Familial Alzheimer’s disease Risk factor Apolipoprotein E 1-antichymotrypsin Very low density lipoprotein receptor IT is now generally accepted that genetic factors are involved in the pathogenesis of Alzheimer’s disease (AD). So far, three disease genes for familial Alzheimer’s disease (FAD) are identi- fied; amyloid precursor protein (APP) (3), presenilin 1 (PS1) (14), and presenilin 2 (PS2) (7,12). In addition, several risk factor genes have been reported. Among them, the 4 allele of apolipoprotein E (ApoE) is known as the major risk factor for AD (2,13), which was confirmed in Japanese populations (11,15). Further, two other genes are postulated; 1-antichymotrypsin (ACT) (6) and very low density lipoprotein receptor (VLDLR) genes (9), in which the risk was significantly increased when the ACT or VLDLR polymor- phism was combined with the ApoE 4 allele. However, these were not confirmed in other studies (1,4,10). Therefore, we conducted studies in Japanese patients to see if any combinations of these three genes increase the risk. MATERIALS AND METHODS Subjects Thirty-one FAD patients from 27 families (13 males, 18 females) and 34 patients with an isolated form of AD (8 males, 26 females) were examined. They all fulfilled the NINCDS-ADRDA criteria (8). All FAD patients except for one showed early onset (65 years old) of the disease (mean age of onset, 50.3 years). Twenty-nine of 34 AD cases were of early onset (mean, 51.6 years). All had no mutations in genes of APP (exons 16 and 17), PS1 (exons 4 –13), and PS2 (exons 4 –13) (the results will be reported precisely elsewhere). Control samples were collected from 163 patients without dementing or mental disorders (75 males and 88 females) and 37 patients with vasucular dementia or other non-Alzheimer dementia. Genomic DNA was extracted from peripheral blood leukocytes and subjected for polymerase chain reaction (PCR) amplification. Statistical analysis was done by the  2 test. ApoE Genotyping The primer sequences used to detect the tri-allelic polymor- phism of ApoE were 5' TCCAAGGAGCTGCAGGCGGCGCA and 5' ACAGAATTCGCCCCGGCCTGGTACACTGCCA (16). PCR was conducted in a final volume of 15 L sample containing 15 ng genomic DNA, 15 pmol of each primer, 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl 2 , 10% (v/v) dimethylsulfoxide, 200 M of each dNTP, and 0.8 units of Taq DNA polymerase. PCR amplification was done by 30 cycles of 1 min. at 94°C, 1 min. at 62°C, and 1 min. at 72°C. The product was digested for 3 h with Hha I, and subjected to electrophoresis in 15% polyacrylamide gel. ACT Genotyping The ACT bi-allelic polymorphism in a single peptide alteration (A/T) was determined by amplification of the 124 bp fragment. 1 Address correspondence to: Takeshi Tabira, National Center Hospital for Nervous, Mental and Muscular Disorders, NCNP, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187, Japan; E-mail: tabira@ncnaxp.ncnp.go.jp. Neurobiology of Aging, Vol. 19, No. 1S, pp. S43–S46, 1998 Copyright © 1998 Elsevier Science Inc. Printed in the USA. All rights reserved 0197-4580/98 $19.00 + .00 PII:S0197-4580(98)00035-9 S43