cDNA Cloning, Gene Characterization and 13q14.3 Chromosomal Assignment of CHC1-L, a Chromosome Condensation Regulator-like Guanine Nucleotide Exchange Factor Marie-Claire Devilder, Emmanuelle Cadoret, Michel Che ´rel, Isabelle Moreau, Gae ¨lle Rondeau, Ste ´phane Be ´zieau, and Jean-Paul Moisan 1 INSERM U463, Institut de Biologie de l’Ho ˆtel-Dieu, Centre Hospitalier Universitaire, 44093 Nantes Cedex, France Received April 30, 1998; accepted July 27, 1998 We report the characterization of a new gene mapped at chromosome band 13q14.3 telomeric to the retinoblastoma gene. This gene, designated CHC1L (for chromosome condensation 1-like), is composed of 14 exons spanning 30 kb of genomic DNA and encodes a ubiquitously expressed 3-kb mRNA. The N-terminal half of the deduced amino acid sequence shows strong homology with the seven tandem repeat structure of the regulator of chromosome condensation RCC1, which acts as a guanine nucleotide exchange factor (GEF) protein for the Ras-related GTPase Ran. CHC1L appears to be a new member of the RCC1-related GEF family. © 1998 Academic Press INTRODUCTION Members of the Ras superfamily of small monomeric G proteins act as molecular switches to control a wide variety of cellular functions. This superfamily can be divided into six subfamilies (Boguski and McCormick, 1993; Quilliam et al., 1995) influencing different pro- cesses such as development and proliferation (Ras) (Denhardt, 1996), cytoskeletal organization (Rho/Rac) (Ridley and Hall, 1992a, 1992b; Ridley et al., 1992), vesicular transport (Rab, Arf/sar) (Donaldson and Klausner, 1994; Novick and Brennwald, 1993; Nuoffer and Balch, 1994; Pfeffer, 1994; Zerial and Stenmark, 1993), and cell cycle progression and nuclear pore com- plex exchange (Ran) (Cheng et al., 1995; Moore and Blobel, 1994a, 1994b; Ren et al., 1995; Schlenstedt et al., 1995). The activity of all known small GTP-binding proteins is regulated by guanine nucleotide exchange and GTP hy- drolysis. These proteins oscillate between GDP- and GTP-bound conformational states (the GDP-bound forms being inactive) (Quilliam et al., 1995). GDP exchange by GTP is mediated by guanine nucleotide exchange fac- tors (GEFs). GEFs associate with GDP-bound forms of GTPases and accelerate GDP dissociation and GTP bind- ing, thereby activating GTPases. This paper reports the cDNA cloning, genomic orga- nization, fine regional assignment, and tissue expres- sion of a new gene whose deduced amino acid sequence shows high homology with the seven intradomain re- peats of the regulator of chromosome condensation (RCC1) gene, which acts as a GEF for Ran (Nishimoto et al., 1978; Ohtsubo et al., 1987). This structure is shared by three other proteins known to have GEF activity for the other small Ras-like GTPase members, Arf and Rab. These homologies suggest that this new gene, called CHC1L for chromosome condensation 1-like, has an associated biochemical function as a GEF protein. MATERIALS AND METHODS Isolation of the complete sequence. dbEST clone 63417 (isolated from a total brain library), which encodes a 2-kb insert corresponding to the 3' end of the cDNA, was purchased from Research Genetics, Inc. (Huntsville, AL). With this insert used as probe, 4  10 5 plaques of a bone marrow oligo(dT) primed and 5' stretch cDNA library (Clontech, Palo Alto, CA) were screened. The longest positive clone was purified and then sequenced in its entirety. The 5' sequences of the cDNA transcript were extended by a standard RACE protocol using oligonucleotide primers derived from the 5' end of the known sequence. The products were isolated using the Marathon Ready cDNA amplification kit and cDNA prepared from a bone marrow template (Clontech). The sequences of the cDNA oligonucleotides were 03, CAGCTGGCTATAAGCATTATGACCC, and 04, GACT- TCTCCTTCTGTTGTTGCAAGG, and those of the vector oligonucle- otides were AP1, CCATCCTAATACGACTCACTATAGGGC, and AP2, ACTCACTATAGGGCTCGAGCGGC. The GenBank accession number for the complete nucleotide sequence was AF060219. Northern blot and expression analysis. Expression studies in hu- man tissues were performed using multiple human tissue mRNA Northern blots (Clontech). Blots were hybridized with 32 P-labeled cDNA clones according to the manufacturer’s instructions. Autora- diography was carried out at -80°C for 2 nights. For RT-PCR, 1 g of human poly(A) + mRNA was reverse-transcribed using a poly(dT) primer. The cDNA was subsequently amplified using different prim- ers. The 5' primer was 31(1), TAACTTTGCTCTAGAAGACAACTT- TACAGG, and the 3' primer was 04, GACTTCTCCTTCTGTTGTT- GCAAGG. 1 To whom correspondence should be addressed. Telephone: (33) 2 40 08 47 48. Fax: (33) 2 40 35 66 97. E-mail: jpmoisan@ nantes.inserm.fr. GENOMICS 54, 99 –106 (1998) ARTICLE NO. GE985498 99 0888-7543/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.