8th World Congress on Genetics Applied to Livestock Production, August 13-18, 2006, Belo Horizonte, MG, Brasil THE EFFECTS OF POLYMORPHISM OF GROWTH HORMONE GENE ON SEMEN CHARACTERISTICS IN IRANIAN HOLSTEIN BULLS N. Asadzadeh 1 , A. Javanmard 2 , M.H. Banabazi 3 , F. Sarhadi 1 1 Dept. of Animal Production and Management, Animal Science Research Institute of IRAN (ASRI), First Dehghan Villa, P.O.Box: 1483, Karaj, IRAN. 2 Dept. of Genomics, West and North-West Agriculture Biotechnology Research Institute of IRAN (ABRII-T). Tabriz, IRAN. 3 Dept. of Biotechnology, Animal Science Research Institute of IRAN (ASRI), First Dehghan Villa, P.O.Box: 1483, Karaj, IRAN. INTRODUCTION Artificial insemination organizations acquire numerous young bulls each year and part of the daily activities involves the collection and evaluation of semen from these potential young sires. Early collections from young bulls are often substandard in term of sperm concentration motility or morphology (1,5, 6). Many quality tests on semen often have low repeatability between observers and are time consuming (14,18,22). The bovine growth hormone (bGH) is a 22 KDa single-chain polypeptide hormone produce in anterior pituitary gland. The encoding gene is approximately 1800 base pair (bp) and consist of five exons separated by four intervening sequence. Recently several studies have investigated association between bGH locus with reproduction traits. A substitution of cytosine(C) for guanine (G) at position 2141 causes an amino acid change from Leucine to Valine(V) at residue 127. This study was designated to evaluate the effects of bovine growth hormone gene genotypes in this position on semen quality. MATERIAL AND METHODS Semen sampling and DNA extraction. Semen of total 89 Holstein bulls from three bull evaluation stations were collected. These samples were evaluated for five semen characteristics consisted Ejaculation volume (ml), Fresh sperm concentration (106cells/ml), Fresh sperm mobility (%), sperm mobility after cryopersevation (106cells/ml) and sperm mortality (%). DNA was extracted from. semen using silica gel method (Boom et. al., 1989). PCR-RFLP and genotyping. One set of primers was used to amplify a 211bp fragment within bovine growth hormone gene, consisting of 49bp of the fourth intron and 162bp from the fifth exon (Gordon et al., 1998): 5'- GCTGCTCCTGAGGGCCCTTC -3' 5'- CATGACCCTCAGGTACGTCTCCG -3' Each PCR reaction were contained 1X of PCR buffer, 2.25mM of MgCl2, 200μM of dNTPs, 1 μM of each primer, 0.2U of Taq polymerase and 50-100ng of genomic DNA. Thermal program was included an initial denaturation at 94°c for 3min followed by 35 cycles denaturation at 94°c for 45s, annealing at 63°c for 1min and extension at 72°c for 1min and final extension at 72°c for 10min. PCR products were digested by AluI enzyme overnight in 37°c. The restricted fragments were then electrophoresed on 2.5% agarose gel which stained by ethidium boromide. Statistical Analysis. Allele frequencies were calculated by direct counting. Data were analyzed using ANOVA procedure according to the following model: