Plant Pathology (2010) 59, 394 Doi: 10.1111/j.1365-3059.2009.02181.x First report of Carnation mottle virus in Turkey B. Cevik*, T. Bakır and G. Koca Department of Plant Protection, Faculty of Agriculture, Suleyman Demirel University 32260 Isparta, Turkey Carnation (Dianthus caryophyllus) is the most important cut flower pro- duced in Turkey. However, yield and quality are lower than carnations from Turkey’s international competitors (Tascıoglu & Sayın, 2005). This could be due to virus infections causing reduction of yield, size and the quality of the flowers. Detection of Carnation mottle virus (CarMV) in other countries (Sanchez-Navarro et al., 1999; Singh et al., 2005) and the presence of suspect plants in Antalya prompted screening for CarMV. Surveys were conducted in the greenhouses of three different carnation producers in Antalya and 17 samples representing 17 different cultivars were collected. Total RNA was isolated from 100 mg leaf samples from plants using a one-step RNA isolation method (BioBasic). A set of primers specific to the conserved sequences of CarMV coat protein (CP) gene was designed (sense BC57 5’ GATCGCGATGAATCCCA CTGTGC 3’ and anti-sense BC58 5’ TCACATCCTATAAACAACCATTG 3’) using sequences available in GenBank. Samples were tested for CarMV by a two-step RT-PCR method, using PrimeScript RT-PCR kit (Takara) and the specific primers. No amplification was observed in the healthy control whereas a 1000 bp fragment corresponding to the CP gene of CarMV was amplified from a positive control. When the greenhouse samples were tested by RT-PCR, the 1000 bp fragment was amplified from 15 of 17 samples demonstrating that major carnation cultivars commonly grown in the most important carnation production region of Turkey were infected with CarMV. To confirm these results, an amplicon from the RT-PCR was sequenced and submitted to GenBank (Accession No. FJ825618). The sequence of the amplicon showed 99% nt identity with the CP gene of CarMV isolate ITALY-ca4 (EF622209). The same samples were also tested for Carnation etch ring virus and Carnation ringspot virus, but none of the samples tested positive. Despite the small sample size, detection of CarMV in all the cultivars grown in the Antalya region indicated that CarMV has potential economical signifi- cance. Although typical mottling symptoms were not observed, growth retardation, narrowed leaves and small flowers resulting in reduced yield and quality of flowers that could be attributed to CarMV infection and represents the first report of CarMV in Turkey. Acknowledgements This study was supported by the Undergraduate Student Grant from TUBITAK. References Sa ´nchez-Navarro JA, Can ˜ izares MC, Cano EA, Pala ´s V, 1999. Simultaneous detection of five carnation viruses by non-isotopic molecular hybridization. Journal of Virological Methods 82, 167–75. Singh HP, Hallan V, Raikhy G et al., 2005. Characterization of an Indian isolate of Carnation mottle virus infecting carnations. Current Science 88, 594–601. Tascı og ˘lu Y, Sayın C, 2005. Structure of cut flower production and export in Turkey. Journal of Akdeniz University Faculty of Agriculture 18, 343–54. *E-mail: bcevik@ziraat.sdu.edu.tr. Accepted 7 July 2009 at http://www.bspp.org.uk/ndr where figures relating to this paper can be viewed. Plant Pathology (2010) 59, 394 Doi: 10.1111/j.1365-3059.2009.02195.x ‘Candidatus Phytoplasma asteris’ identified in blackberry (Rubus fruticosus agg.) in the United Kingdom R. Reeder a *, P. L. Kelly a and Y. Arocha b a Global Plant Clinic, CABI, Egham, Bakeham Lane, Egham, TW20 9TY, UK; and b Rothamsted Research, Harpenden, AL5 2JQ, UK Blackberries (Rubus fruticosus agg.) also known as brambles are a wide- spread and well-known aggregate species of several hundred micro-spe- cies native throughout the temperate Northern hemisphere. Tolerating poor soils, they are early colonizers of wasteland and building sites and grow vigorously in woods, scrubland, hedgerows and roadside verges. Plants produce many soft fruits notable for their high nutritional content, making them a popular ingredient in desserts, jams and wines. Numerous cultivars have been selected for commercial cultivation. In July 2008, a small patch of R. fruticosus growing by the roadside in Egham, UK, was observed showing unusual witches’ broom symptoms. Proliferations of shoots were seen at the branch nodes, midway along the stem. Symptoms on new growth presented as shortened, narrowed almost leafless branches with reduced, flower production or none at all. No other plants in the near vicinity appeared affected. Total DNA was extracted from plants with symptoms and from healthy looking blackberry plants and used as a template in a nested PCR assay with universal primers P1m (Hren et al., 2007) / P7 (Gundersen & Lee, 1996) and fU5 / rU3 (Lorenz et al., 1995). Amplicons of expected size (~880 bp) were obtained from plants with symptoms. Nested amplicons of a representative plant were purified, cloned (pGEM-T Easy Vector, Promega) and sequenced in both directions using M13 sequencing prim- ers (http://www.dnaseq.co.uk). The phytoplasma 16Sr rDNA sequence (GenBank Accession No. FJ008925) was compared with those held in GenBank using BLAST. The greatest similarity (99%) was with phytoplasmas of group 16SrI, ‘Candidatus Phytoplasma asteris’, includ- ing those associated with gaillardia yellows (EF583066), poa stunt (DQ640502), and festuca yellows (DQ640504). The occurrence of two phytoplasmas belonging to groups 16SrV (‘Ca. P. ulmi’) and 16SrIII (X-disease) have previously been reported in Rubus species in the UK (Davies, 2000). This is the first record of a phytoplasma from 16SrI group recorded from Rubus in the UK. It is not known which insect vectors are associated with transmission. References Davies DL, 2000. The occurrence of two phytoplasmas associated with stunted Rubus species in the UK. Plant Pathology 49, 86–8. Gundersen DE, Lee IM, 1996. Ultrasensitive detection of phytoplasmas by nested- PCR assays using two universal primer pairs. Phytopathologia Mediterranea 35, 144–51. Hren M, Boben J, Rotter A, Kralj P, Gruden K, Ravnikar M, 2007. Real-time PCR detection systems for Flavescence dore ´e and Bois noir phytoplasmas in grapevine: comparison with conventional PCR detection and application in diagnostics. Plant Pathology 56, 785–96. Lorenz K-H, Schneider B, Ahrens U, Seemu ¨ ller E, 1995. Detection of the apple proliferation and pear decline phytoplasma by PCR amplification of ribosomal and non-ribosomal DNA. Phytopathology 85, 771–6. *E-mail: r.reeder@cabi.org. Accepted 31 July 2009 at http://www.bspp.org.uk/ndr where figures relating to this paper can be viewed. 394 ª 2010 The Authors Journal compilation ª 2010 BSPP