Acta Cryst. (1999). D55, 677±678 Charnock & Davies spsA transferase 677 crystallization papers Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Cloning, crystallization and preliminary X-ray analysis of a nucleotide-diphospho-sugar transferase spsA from Bacillus subtilis Simon J. Charnock and Gideon J. Davies* Structural Biology Laboratory, Department of Chemistry, University of York, Heslington, York YO10 5DD, England Correspondence e-mail: davies@yorvic.york.ac.uk # 1999 International Union of Crystallography Printed in Denmark ± all rights reserved Nucleotide-diphospho-sugar transferases represent, in terms of quantity, one of the most important groups of enzymes on Earth, yet little is known about their structure and mechanism. Such a transferase, the spsA gene product involved in the synthesis of the bacterial spore coat in Bacillus subtilis, has been cloned and over- expressed in an Escherichia coli expression system. Crystals have been grown, using PEG 8000 as a precipitant, in a form suitable for high-resolution X-ray analysis. They belong to space group C222 1 , with unit-cell dimensions a = 42.4, b = 142.0, c = 81.4 A Ê and with one molecule of spsA in the asymmetric unit. The crystals diffract beyond 1.5 A Ê using synchrotron radiation. Received 14 September 1998 Accepted 7 October 1998 1. Introduction Glycosyltransferases (E.C. 2.4.x.y), catalyse the formation of glycosidic bonds. They use a donor sugar activated by the presence of a nucleotide-diphospho group and catalyse the reaction NDP Sugar HOR! NDP Sugar O R: 1 They are responsible for the production of di-, oligo- and polysaccharides and complex carbohydrates such as lipopolysaccharides and glycosylated proteins. They thus play a central role in food storage, structure and cellular signalling. Despite the wealth of sequences that are available for these enzymes (Campbell et al., 1997), little is known about their structures or mechanisms (reviewed in Davies et al. , 1997). The spsA gene encodes a glycosyltransferase involved in the production of the mature spore-coat during the bacterial spore response (Glaser et al., 1993; Roels & Losick, 1995; Stragier & Losick, 1996). It encodes a protein of 256 amino acids whose exact substrate speci®city is as yet unclear. The endospore cell wall from B. subtilis contains a complex peptidoglycan featuring N-acetylglucosamine, N-acetylmuramic acid and muramic acid -lactam (Atrih et al., 1996). As such, a wide spectrum of NDP-sugars and acceptor mole- cules are potential substrates. Analogy with other bacterial systems suggests that a UDP- or TDP-linked sugar is the most likely donor, but the acceptor species is particularly dif®cult to de®ne. It is possible, however, to derive consider- able information form the amino-acid sequence alone. A classi®cation of nucleotide- diphospho-sugar transferases based on amino- acid sequence similarity placed spsA in family 2 (Campbell et al., 1997). SpsA thus displays high sequence similarity with other glycosyl- transferases involved in spore synthesis such as cgeD (Roels & Losick, 1995) and with a large number of open reading frames identi®ed during genomic sequencing of many organisms. The substrates for these enzymes also remain elusive. The closest similarity, for an enzyme whose substrates are well characterized, is with one of the root-nodulation factors NodC, a UDP-N-acetylglucosamine transferase, which displays approximately 21% sequence identity with spsA. Family 2 of the glycosyltransferases contains enzymes which act with net inversion of anomeric con®guration, utilizing -linked NDP-sugars to generate products with - anomeric con®guration. The spsA structure should therefore provide a simple model system for family 2 transferases, many of which are complex membrane-bound enzymes with multiple catalytic domains. In this paper, we present the cloning and over-expression of the spsA gene in an E. coli expression system, together with the crystallization and preli- minary X-ray analysis. Crystals of spsA diffract to beyond 1.5 A Ê using synchrotron radiation. 2. Materials and methods 2.1. Cloning, expression and puri®cation Vent DNA polymerase (New England Biolabs) and the oligonucleotide primers CATATGCCTAAAGTATCAGTCATT and CTCGAGGGCCGACAAGCTCTC were used to generate a PCR fragment from the genome of B. subtilis containing the spsA gene ¯anked by NdeI and XhoI restriction sites, respectively. The 0.79 kbp synthetic product was cloned blunt-ended into pCR-Blunt