doi: 10.1111/j.1744-313X.2005.00541.x © 2005 Blackwell Publishing Ltd, International Journal of Immunogenetics 32, 379 –382 379 Blackwell Publishing, Ltd. Novel polymorphism in the promoter region of the human nerve growth-factor gene M. Alam,* V. Pravica,* A. A. Fryer,† C. P. Hawkins† & I. V. Hutchinson* Summary We describe a novel T to C transition at position -198 from the transcription start of the human nerve growth- factor (NGF) gene. In British Caucasoid healthy control group that we have genotyped, T and C allele frequencies are 0.633 and 0.367, respectively. This polymorphism affects vitamin D receptor (VDR) binding to its motif in the NGF promoter. Nerve growth factor Nerve-growth factor (NGF) is a pleiotropic cytokine and has a variety of functions. Generally, it is essential for the survival and development of sympathetic neurons. It exerts actions on cells outside of the central and peripheral nervous system and has been found best for the survival of cutaneous sensory neurons. This cytokine affects the growth and differentiation of several types of leucocytes. Importantly, it may have an interfacing role between the immune and the nervous systems. Originally recognized as a growth factor crucial for the development of neuronal cells, NGF has sources and important functions outside the CNS, particularly involving immunological pathways. A definite immunological profile has not yet been ascertained for NGF, but there is evidence that it is involved in the regulation of inflammatory processes, depending on cell type and cellular conditions (Ehrhard et al., 1993; Ransohoff & Trebst, 2000; Villoslada et al., 2000; Vega et al., 2003). We have characterized a single-base substitution within the promoter region of the human NGF gene. Investigating putative polymorphisms A DNA fragment from 30 healthy British Caucasoid volunteers, corresponding to the region -257 to +9944 relative to the transcription start of the NGF gene was amplified using 12 primer pairs. Region -257 to +45 of the gene was found to contain a polymorphic site (primer sequences used in SSCP-PCR are detailed in the succeeding discussion). PCR conditions The polymerase chain-reaction (PCR) method was used to amplify various regions of the NGF gene. The final reaction volume for each PCR was 30 μL including 2 μL of DNA (50–200 ng μL -1 ), and the reagents were mixed as follows: Reagent Amount (final conc.) 10× potassium chloride 3.0 μL reaction buffer (Mg ++ free) DNTPs (2.0 mm, ABgene, UK) 3.0 μL (200 μm) 25 mm magnesium chloride 3.0 μL (2.5 mm) (MgCl 2 ) (ABgene, UK) Betaine (4 m, Sigma, UK) 7.5 μL (1 m) Sense / forward primer (10 μm) 2.0 μL (0.67 μm) Antisense / reverse primer (10 μm) 2.0 μL (0.67 μm) Thermophilus aquaticus 0.2 μL (1 U) polymerase (Taq polymerase 5 U μL -1 , ABgene, UK) Distilled water up to 30.0 μL PCR primers for region -257 to +45 of the NGF gene Forward primer 5′ GTGGGTTTCCCTTTGACCTC 3′ Reverse primer 5′ AGCCTGACTCACCGCTGCG 3′ PCR amplifications were carried out on a PTC-100 (Genetic Research Instrumentation Ltd, Dunmow, UK) thermal cycler. The PCR products with loading buffer (Bioline, UK) were electrophoresed in 2% agarose gel containing ethidium bromide at 100 V for approximately 30 min. Single-stranded conformational-polymorphism analysis (SSCP) PCR products were analysed by the SSCP method as previously described (Orita et al., 1989). Briefly, 6 μL of PCR products were denatured at 95 °C for 5 min with 6 μL of loading buffer (80% v / v formamide, 10 mm NaOH, 1 mm EDTA pH 8.0, 0.1% w/v bromphenol * Faculty of Life Sciences, The University of Manchester, Oxford Road, Manchester M13 9PT, UK and † University Hospital of North Staffordshire, Hartshill Road, Stoke-on-Trent, Staffordshire ST4 7EA, UK Received 31 March 2005; revised 22 July 2005; accepted 22 July 2005 Correspondence: Vera Pravica, Faculty of Life Sciences, The University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, UK Tel: +44 (0) 161 275 5234; Fax: +44 (0) 161 275 5082. E-mail: vera.pravica@manchester.ac.uk