~ 1173 ~ Journal of Pharmacognosy and Phytochemistry 2017; 6(5): 1173-1177 E-ISSN: 2278-4136 P-ISSN: 2349-8234 JPP 2017; 6(5): 1173-1177 Received: 23-07-2017 Accepted: 25-08-2017 Madhusudhan R Department of Plant Biotechnology, University of Agricultural Sciences, GKVK, Bangalore, India Neha Guleria Department of Plant Biotechnology, University of Agricultural Sciences, GKVK, Bangalore, India Satish Kumar K Department of Plant Biotechnology, University of Agricultural Sciences, GKVK, Bangalore, India Ramanjini Gowda PH Department of Plant Biotechnology, University of Agricultural Sciences, GKVK, Bangalore, India Correspondence Neha Guleria Department of Plant Biotechnology, University of Agricultural Sciences, GKVK, Bangalore, India Effect of gene copy number, methanol and time period on production of CVS rabies glycoprotein expressed in Pichia pastoris Madhusudhan R, Neha Guleria, Satish Kumar K and Ramanjini Gowda PH Abstract Rabies is a viral disease that causes acute encephalitis in warm blooded animals. Rabies is almost invariably fatal if post-exposure prophylaxis is not administered prior to the onset of severe symptoms. Glycoprotein is the major surface protein of rabies virus, responsible for the production of neutralizing antibodies. Currently, available mammalian cell culture based rabies vaccine is highly expensive because of cell line maintenance and downstream processes. Large quantity of this vaccine is required to meet the clinical requirements at economical level. Therefore, the present investigation was conducted to study the effect of multicopy gene insertion, methanol concentration and incubation time interval on the protein expression of challenge virus standard (CVS) rabies glycoprotein (RGP) in Pichia pastoris. The optimal methanol concentration and incubation time for induced CVS rabies glycoprotein were 1 % (w/v) and 96 h respectively. Clone 13 (single copy number) produced 0.4g/l whereas Clone 14 (5 copies) produced 1.5 g/L of recombinant protein. The clone with five copy number expressed CVS_RGP at a higher level than single copy number clone. Therefore, the gene copy number is one of the major factor involved in heterologous protein expression in P. pastoris. Keywords: Gene copy number, Pichia pastoris, Rabies glycoprotein, Western blot 1. Introduction Rabies is one of the oldest zoonotic diseases known to man, but its successful control has remained elusive. The rhabdovirus causes acute encephalitis in warm-blooded animals. The World Health Organization (WHO) estimates 55,000 human deaths due to rabies every year [1] . The worldwide incidence of rabies and the inability of currently used vaccination strategies to provide highly potent and cost-effective therapy indicate the need for an improved rabies vaccine. Glycoprotein (G) is the major surface protein of rabies virus, responsible for the production of neutralizing antibodies and hence, the subunit vaccines that contain G could provide complete protection against RV challenge [2] . One of the most important elements in the effective control of rabies is through the use of efcacious vaccines. Pichia pastoris, an eukaryotic methylotrophic yeast, has emerged as one of the powerful host systems for the production of biopharmaceuticals. It has many advantages as an expression system including a tightly controlled and strong AOX1 promoter, a cell capable of post-translational processes, the ability to grow to high cell densities and high expression rates [3] . There are many factors which influence the expression yield of foreign proteins in the multistep, tightly regulated protein biosynthesis pathway of yeast. Generally, a gene copy number have been identified as one of the most important factors influencing the heterologous protein expression in Pichia pastoris [4] . However, the number of integrated expression cassettes does not always correlate with the yield of recombinant proteins, particularly in the case of secreted proteins [5] . Earlier we have reported recombinant and stable expression of CVS_RGP in pPICZαA P. pastoris vector at single copy insertion [6] . Hence, in the present study, we report the multimerization and molecular characterization of CVS_RGP produced in P. pastoris. 2. Materials and Methods Construction of recombinant P. pastoris expression plasmid (pPIC9K CVS_RGP) The P. pastoris strain GS115 cells and plasmid pPIC9Kwas used to construct the multicopy CVS_RGP expression vector The CVS_RGP gene was amplified using Forward primer sequence with EcoRI site GCAGCAGAATTCATGGTTCCTCAGCCTGCTCTCCT and Reverse primer sequence with NotI site TAATGCGGCCGCCAGTCTGGTCTGACCC CCACCACT. The PCR production was digested and inserted at EcoRI and NotI sites in the