INFECTION AND IMMUNITY,
0019-9567/00/$04.0010
Aug. 2000, p. 4795–4801 Vol. 68, No. 8
Copyright © 2000, American Society for Microbiology. All Rights Reserved.
Sunlight-Induced Propagation of the Lysogenic Phage
Encoding Cholera Toxin
SHAH M. FARUQUE,
1
* ASADULGHANI,
1
M. MOSTAFIZUR RAHMAN,
1
MATTHEW K. WALDOR,
2
AND DAVID A. SACK
1
Molecular Genetics Laboratory, International Centre for Diarrhoeal Disease Research, Bangladesh,
Dhaka-1000, Bangladesh,
1
and Division of Geographic Medicine, Tupper Research Institute,
New England Medical Center, Boston, Massachusetts 02111
2
Received 9 February 2000/Returned for modification 17 April 2000/Accepted 8 May 2000
In toxigenic Vibrio cholerae, the cholera enterotoxin (CT) is encoded by CTXF, a lysogenic bacteriophage.
The propagation of this filamentous phage can result in the origination of new toxigenic strains. To understand
the nature of possible environmental factors associated with the propagation of CTXF, we examined the effects
of temperature, pH, salinity, and exposure to direct sunlight on the induction of the CTX prophage and studied
the transmission of the phage to potential recipient strains. Exposure of cultures of CTXF lysogens to direct
sunlight resulted in ;10,000-fold increases in phage titers. Variation in temperature, pH, or salinity of the
culture did not have a substantial effect on the induction of the prophage, but these factors influenced the
stability of CTXF particles. Exposure of mixed cultures of CTXF lysogens and potential recipient strains to
sunlight significantly increased both the in vitro and in vivo (in rabbit ileal loops) transduction of the recipient
strains by CTXF. Included in these transduction experiments were two environmental nontoxigenic (CTXF
2
)
strains of V. cholerae O139. These two O139 strains were transduced at high efficiency by CTXF, and the phage
genome integrated into the O139 host chromosome. The resulting CTXF lysogens produced biologically active
CT both in vitro and in rabbit ileal loops. This finding suggests a possible mechanism explaining the origi-
nation of toxigenic V. cholerae O139 strains from nontoxigenic progenitors. This study indicates that sunlight
is a significant inducer of the CTX prophage and suggests that sunlight-induced transmission of CTXF may
constitute part of a natural mechanism for the origination of new toxigenic strains of V. cholerae.
Seasonal outbreaks of cholera caused by toxigenic Vibrio
cholerae strains are a major public health problem in many
developing countries. Toxigenic V. cholerae O1 and O139
strains cause disease by colonizing the human small intestine,
where they produce a potent enterotoxin, the cholera toxin
(CT), which is principally responsible for the severe watery
diarrhea characteristic of cholera (5, 23). The ctxAB operon,
which encodes the A and B subunits of CT, is part of a larger
genetic element originally termed the CTX genetic element
(22). Recent studies have shown that the CTX genetic element
corresponds to the genome of CTXF, a lysogenic filamentous
bacteriophage (28). It has been previously demonstrated that
naturally occurring strains of toxigenic V. cholerae produce
high titers of the phage following exposure to the DNA-dam-
aging agent mitomycin C, and cell-free phage particles can
infect and convert susceptible nontoxigenic V. cholerae strains
into toxigenic strains (6, 7). Similar to other temperate phages,
the CTX prophage can also be induced by exposure to UV
irradiation under laboratory conditions. However, no studies
have been conducted so far to identify possible natural factors
associated with the induction and propagation of CTXF.
Although toxigenic V. cholerae bacteria are human patho-
gens, the species can persist in the aquatic environment in the
absence of human hosts. Therefore, the ecology of V. cholerae
appears to involve both environmental and human host com-
ponents (2, 5). During survival in the aquatic environment, the
physiological state of V. cholerae is not well understood but is
presumably influenced by various parameters, including sun-
light, temperature, pH, and salinity (19, 25). It is not clear
whether these factors can also result in the induction of CTX
prophages in toxigenic V. cholerae and hence promote the
transmission of CTXF to nontoxigenic environmental strains,
leading to the origination of new toxigenic strains. In the
present study, we examined the effects of temperature, pH,
salinity, and exposure to direct sunlight on the induction, sta-
bility, and propagation of CTXF.
Naturally occurring toxigenic V. cholerae strains used in the
present study included 32 strains belonging to the O1, O139,
and non-O1 non-O139 serogroups, and the strains were iso-
lated from cholera patients or environmental surface water in
Bangladesh (see Table 3). The nontoxigenic V. cholerae strains
used in the transduction studies or as controls included two
O139 strains and three El Tor strains isolated in Bangladesh or
India. The genetically marked phage IG-KmF was a derivative
of CTXF into which a kanamycin resistance (Km
r
) determi-
nant was introduced into an intergenic NotI site (16). Strain
ASF-1 carried a chromosomally integrated copy of the IG-
KmF genome and was constructed by lysogenic conversion of
CT-negative V. cholerae O1 El Tor strain SA-317 with IG-
KmF. Strain SM44 was a derivative of toxigenic El Tor strain
P27459 in which the CTX element was marked with a Km
r
determinant (10). The genetically marked phage CTX-KmF
was derived from strain SM44 as described previously (6, 7,
28). Properties of the control bacterial strains and phages used
in this study are presented in Table 1.
The gene probe used in this study to detect the CTXF
genome was a 0.5-kb EcoRI fragment of pCVD27 (6, 12).
Strand-specific oligonucleotide probes with the sequences 59T
CTATCTCTGTAGCCCCTATTACG and 59CTCAGACGG
GATTTGTTAGGCACG, for probing the plus and minus
strands, respectively, were also used to detect the presence of
* Corresponding author. Mailing address: Molecular Genetics Lab-
oratory, Laboratory Sciences Division, ICDDR,B, GPO Box 128,
Dhaka-1000, Bangladesh. Phone: 880 2 8811751 to 880 2 8811760. Fax:
880 2 8812529 and 880 2 8823116. E-mail: faruque@icddrb.org.
4795