INFECTION AND IMMUNITY, 0019-9567/00/$04.0010 Aug. 2000, p. 4795–4801 Vol. 68, No. 8 Copyright © 2000, American Society for Microbiology. All Rights Reserved. Sunlight-Induced Propagation of the Lysogenic Phage Encoding Cholera Toxin SHAH M. FARUQUE, 1 * ASADULGHANI, 1 M. MOSTAFIZUR RAHMAN, 1 MATTHEW K. WALDOR, 2 AND DAVID A. SACK 1 Molecular Genetics Laboratory, International Centre for Diarrhoeal Disease Research, Bangladesh, Dhaka-1000, Bangladesh, 1 and Division of Geographic Medicine, Tupper Research Institute, New England Medical Center, Boston, Massachusetts 02111 2 Received 9 February 2000/Returned for modification 17 April 2000/Accepted 8 May 2000 In toxigenic Vibrio cholerae, the cholera enterotoxin (CT) is encoded by CTXF, a lysogenic bacteriophage. The propagation of this filamentous phage can result in the origination of new toxigenic strains. To understand the nature of possible environmental factors associated with the propagation of CTXF, we examined the effects of temperature, pH, salinity, and exposure to direct sunlight on the induction of the CTX prophage and studied the transmission of the phage to potential recipient strains. Exposure of cultures of CTXF lysogens to direct sunlight resulted in ;10,000-fold increases in phage titers. Variation in temperature, pH, or salinity of the culture did not have a substantial effect on the induction of the prophage, but these factors influenced the stability of CTXF particles. Exposure of mixed cultures of CTXF lysogens and potential recipient strains to sunlight significantly increased both the in vitro and in vivo (in rabbit ileal loops) transduction of the recipient strains by CTXF. Included in these transduction experiments were two environmental nontoxigenic (CTXF 2 ) strains of V. cholerae O139. These two O139 strains were transduced at high efficiency by CTXF, and the phage genome integrated into the O139 host chromosome. The resulting CTXF lysogens produced biologically active CT both in vitro and in rabbit ileal loops. This finding suggests a possible mechanism explaining the origi- nation of toxigenic V. cholerae O139 strains from nontoxigenic progenitors. This study indicates that sunlight is a significant inducer of the CTX prophage and suggests that sunlight-induced transmission of CTXF may constitute part of a natural mechanism for the origination of new toxigenic strains of V. cholerae. Seasonal outbreaks of cholera caused by toxigenic Vibrio cholerae strains are a major public health problem in many developing countries. Toxigenic V. cholerae O1 and O139 strains cause disease by colonizing the human small intestine, where they produce a potent enterotoxin, the cholera toxin (CT), which is principally responsible for the severe watery diarrhea characteristic of cholera (5, 23). The ctxAB operon, which encodes the A and B subunits of CT, is part of a larger genetic element originally termed the CTX genetic element (22). Recent studies have shown that the CTX genetic element corresponds to the genome of CTXF, a lysogenic filamentous bacteriophage (28). It has been previously demonstrated that naturally occurring strains of toxigenic V. cholerae produce high titers of the phage following exposure to the DNA-dam- aging agent mitomycin C, and cell-free phage particles can infect and convert susceptible nontoxigenic V. cholerae strains into toxigenic strains (6, 7). Similar to other temperate phages, the CTX prophage can also be induced by exposure to UV irradiation under laboratory conditions. However, no studies have been conducted so far to identify possible natural factors associated with the induction and propagation of CTXF. Although toxigenic V. cholerae bacteria are human patho- gens, the species can persist in the aquatic environment in the absence of human hosts. Therefore, the ecology of V. cholerae appears to involve both environmental and human host com- ponents (2, 5). During survival in the aquatic environment, the physiological state of V. cholerae is not well understood but is presumably influenced by various parameters, including sun- light, temperature, pH, and salinity (19, 25). It is not clear whether these factors can also result in the induction of CTX prophages in toxigenic V. cholerae and hence promote the transmission of CTXF to nontoxigenic environmental strains, leading to the origination of new toxigenic strains. In the present study, we examined the effects of temperature, pH, salinity, and exposure to direct sunlight on the induction, sta- bility, and propagation of CTXF. Naturally occurring toxigenic V. cholerae strains used in the present study included 32 strains belonging to the O1, O139, and non-O1 non-O139 serogroups, and the strains were iso- lated from cholera patients or environmental surface water in Bangladesh (see Table 3). The nontoxigenic V. cholerae strains used in the transduction studies or as controls included two O139 strains and three El Tor strains isolated in Bangladesh or India. The genetically marked phage IG-KmF was a derivative of CTXF into which a kanamycin resistance (Km r ) determi- nant was introduced into an intergenic NotI site (16). Strain ASF-1 carried a chromosomally integrated copy of the IG- KmF genome and was constructed by lysogenic conversion of CT-negative V. cholerae O1 El Tor strain SA-317 with IG- KmF. Strain SM44 was a derivative of toxigenic El Tor strain P27459 in which the CTX element was marked with a Km r determinant (10). The genetically marked phage CTX-KmF was derived from strain SM44 as described previously (6, 7, 28). Properties of the control bacterial strains and phages used in this study are presented in Table 1. The gene probe used in this study to detect the CTXF genome was a 0.5-kb EcoRI fragment of pCVD27 (6, 12). Strand-specific oligonucleotide probes with the sequences 59T CTATCTCTGTAGCCCCTATTACG and 59CTCAGACGG GATTTGTTAGGCACG, for probing the plus and minus strands, respectively, were also used to detect the presence of * Corresponding author. Mailing address: Molecular Genetics Lab- oratory, Laboratory Sciences Division, ICDDR,B, GPO Box 128, Dhaka-1000, Bangladesh. Phone: 880 2 8811751 to 880 2 8811760. Fax: 880 2 8812529 and 880 2 8823116. E-mail: faruque@icddrb.org. 4795