Australian Journal of Basic and Applied Sciences, 3(1): 160-166, 2009 ISSN 1991-8178 Corresponding Author: Azza.A. Abou Zeid, Faculty of Science, Botany Department, Zagazig University, Egypt. azza.abozeid@yahoo.com 160 Molecular Characterization and Enterotoxin Genes Typing of Local Strains of Bacillus Cereus Azza.A. Abou Zeid Faculty of Science, Botany Department, Zagazig University,Egypt. Abstract: Two virulent strains of Bacillus cereus coded as BC13 and BC37 isolated from corn snacks collected from Egyptian market were identified using biochemical and staining methods. Further confirmation was done by determining their cellular protein pattern compared to a standard culture of B. cereus NRRL 569. The cellular protein profile revealed 97.55 to 99% similarity between NRRL 569 reference strain and local strains (BC13, BC37 ) . Random amplification polymerase DNA analysis of the two tested isolates compared to standard culture using eleven arbitrary primers showed similarities ranging from 75.5% to 77.09% between the tested isolates. Separation of extracellular proteins of both tested isolates using SDS-PAGE revealed the presence of protein bands with molecular weights between 34 and 54 kDa in both tested isolates, suspected as enterotoxins. To ensure the presence of suspected enterotoxins, two pairs of primers newly designed and reported during year 2008 (FHblC and RHblC) and (FCytK and R2Cytk) were used to detect the toxin genes in both tested isolates using multiplex PCR technique. The two primers were designed as (CCTATCAATACTCTCGCAA & TTTCCTTTGTTATACGCTGC) and (CGACGTCACAAGTTGTAACA& CGTGTGTAAATACCCCAGTT). The multiplex PCR amplification allowed rapid detection and identification of the toxin genes (hblC and cyt K) in both isolates. Key words: Bacillus cereus, molecular biology, protein pattern, enterotoxin genes, multiplex PCR. INTRODUCTION Bacillus cereus is often present in a variety of food such as milk, dairy products, spices, cereals, meat, cakes, deserts….etc. (Larsen and Jorgensen, 1997; Duc et al., 2005 and Svensson et al.,2007). B. cereus has been extensively reported to be involved in outbreaks of gastrointestinal diseases (emetic and diarrheal).The emetic toxin is a heat stable small ring forming peptide (Lund et al., 2000) and enterotoxin FM (Asano et al., 1997). Meanwhile the diarrheal disease is the most common form and is caused by at least four heat labile enterotoxins; hemolysin HBL ( Beecher and Wong, 1997), nonhemolytic NHE (Lindback et al., 2004), cytotoxin CytK (Lund et al., 2000). Cytotoxin CytK was reported as the primary virulence factors in B.cereus diarrhea toxic syndrome (Lund et al., 2000; Guinebretiere et al., 2002 and Brillard and Lereclus, 2007). HBL and NHE toxins are both three protein components complexes. HBL contains two lytic components [L1 and L2] and a binding component B encoded HBLC, HBLD& HBLA. NHE also contains two lytic elements NHEA & NHEB and a third protein encoded NHEC with unknown function (Granum et al., 1999). Detection of toxin genes of B. cereus has been proposed by several authors in terms of polymerase chain reaction PCR primers of toxin subunits since the toxins were cloned and sequenced (Rayan et al., 1997; Lund et al., 2000; Duc et al., 2005; Svensson et al., 2007 and Ngamwongsatit et al., 2008). In this study, it was attempted to detect the hemolytic enterotoxin genes in two identified and molecularly confirmed local isolates of B. cereus (BC37& BC13) by rapid multiplex PCR technique using specific novel primers for the subunits HBLC and CytK in a single reaction. MATERIALS AND METHODS Selection of bacterial strains: The two tested bacterial strains were chosen from a collection of bacterial cultures which has been isolated from corn snack packets collected from the market in Zagazig city, Egypt. Both strains were highly potent concerning their virulence factors namely, phospholipase, hemolysins and protease (data not shown). The isolates were plated on B. cereus selective agar supplemented by 8%egg yolk suspension and polymxin B (100