Supplementary Material Metagenomic insights into the metabolism of microbial communities that mediate iron and methane cycling in Lake Kinneret sediments Michal Elul*, Maxim Rubin-Blum, Zeev Ronen, Itay Bar-Or, Werner Eckert, Orit Sivan * Correspondence: Michal Elul, e-mail: elul@post.bgu.ac.il 1 Supplementary Methods Method S1: Analysis of microbial diversity in slurry incubations based on the 16S rRNA gene amplicon sequencing. Total genomic DNA was extracted from duplicate samples of the slurries using the MoBio Power Soil DNA isolation kit (MoBio Laboratories, Solana Beach, CA). Genomic DNA was eluted using 80 μl of elution buffer and stored at −20°C. Duplicates of 16S rRNA gene fragments were joined together and amplified by PCR using a Biometra T Gradient thermocycler (Biometra, Göttingen, Germany) for MiSeq sequencing. Linkered primers that were used are 41F/806R for bacteria: (CS1-341F: 5'-ACACTGACGACATGGTTCTACACCTACGGGAGGCAGCAG, CS2- 806R:5’-TAC-GGTAGCAGAGACTTGGTCTGGACTACHVGGGTWTCTAAT) and Ar915- Ar1386 for archaea (CS1_Ar915F:5'-ACACTGACGACATGGTTCTACAAGGAATTGGCGGGGGAGCAC, CS2_Ar1386R: TACGGTAGCAGAGACTTGGTCTGCGGTGTGTGCAAGGAGC) for an 16S rRNA genes. All primer sets were used in PCR amplification in parallel with Dream Taq (Fermentas, Litvania). From PCR protocol initial denaturation step of 2 min at 95°C was followed by 30 cycles of the following incubation pattern at 95°C for 20 s, 52/59°C for 20 s for bacteria or archaea, respectively, and 56°C for 65 s. A final extension at 65°C for 7 min completed the reaction. Illumina MySeq sequencing of the PCR products was performed at DNA Services (DNAS) Facility (Research Resources Center University of Illinois at Chicago). Demultiplexed paired-end reads were analyzed using QIIME2 V2019.7 (Rideout et al. 2018). Reads were truncated based on quality plots, checked for chimeras, merged and grouped into amplicon sequence variants (ASVs) with DADA2 (Callahan et al. 2016), as implemented in QIIME2. A Naïve-Bayes classifier trained on the Silva 132 full 99%-clustered 16S rRNA sequences. Representative sequences were aligned with MAFFT (Katoh and Standley 2013), masked, and trees were generated using FastTree (Price et al. 2009), as implemented in QIIME2. Downstream statistical analyses and plotting were performed in R (R Core Team 2018), using libraries phyloseq (McMurdie and Holmes 2013), ampvis2 (Andersen et al. 2018) and ggplot2 (Wickham 2009).