Clin Chem Lab Med 2018; aop Letter to the Editor Raffaella Accetta, Leonardo Campiotti, Lorenzo Elli, Rosario Casalone and Francesco Pallotti* A particular case of AML patient with the polymorphism G105G (rs11554137) and the missense mutation R132C in IDH1 gene https://doi.org/10.1515/cclm-2018-0349 Received April 5, 2018; accepted June 20, 2018 Keywords: acute myeloid leukemia (AML); IDH1; prognos- tic value. To the Editor, Acute myeloid leukemia (AML) is a hematological malig- nancy caused by acquired genetic alterations in genes affect- ing the normal proliferation and terminal differentiation. Genome-wide analysis in patients with AML has identified several new genetic markers, in addition to FLT3 and NPM1 gene mutations, that can improve the prognostic clinical evaluation, mainly in patients with a normal karyotype, thus contributing to the development of novel target therapies. Mutations in the isocitrate dehydrogenase (IDH) 1 and 2 genes were first identified in malignant gliomas and subsequently found in about 21% [1–4] of patients with de novo or secondary AML. IDH1 and IDH2 are homodimeric enzymes that reversibly convert isocitrate to α-ketoglutarate (α-KG) in the cytoplasm and mito- chondria, respectively, with concomitant reduction of NADP+ to NADPH. In addition, IDH1/2 mutations confer a new enzymatic gain of function, by converting α-KG to 2-hydroxiglutarate (2-HG) with a reduction of NADPH: NADP+ ratio, resulting in a hypermethylation phenotype and impaired hematopoietic differentiation [5]. IDH1/2 missense mutations are usually heterozygous, affecting the arginine at codon 132 in exon 4 in the IDH1 gene, codon 140 and codon 172 in exon 4 in the IDH2 gene. Furthermore, a synonymous single nucleotide polymor- phism (SNP c. 315 C>T; rs11554137), located in codon 105 in exon 4 in the IDH1 gene, was reported as an independ- ent prognostic factor with an impact on overall survival in AML patients [4, 6]. Informed consent for genetic analysis was obtained from the patient at the moment of hospital admission. Several research groups reported that mutations in IDH1 and IDH2 genes were mutually exclusive [4] except for some cases [7] and predominantly associated with normal karyotype (CN-AML) or isolated trisomy 8, NPM1 mutations and FAB M1 AML subtype [1, 3, 8, 9]. All patients harboring IDH mutations are usually older than IDH-negative patients, with lower white blood cell (WBC) count and an high platelet count, even if the difference in age is related only to IDH2 mutations [7, 8]. In this report, we describe a patient with AML exhibiting two genetic variants (a SNP and a mutation) in IDH1 gene. In order to perform molecular analyses, Ficoll density gradient centrifugation was performed for the isolation of mononuclear cells from bone marrow samples. Genomic DNA was extracted using Blood MINI KIT (QIAGEN) and DNA fragments spanning the entire exon 4 of IDH1 and IDH2 were amplified by using Taq Polymerase (Promega) with subsequent Sanger sequencing. The primer sequences used to amplify both IDH genes exon 4 were: IDH1 forward primer (5′ctcagagccttcgctttctg) and reverse primer (5′cacatacaagttggaaatttctgg) and of IDH2 forward primer (5′ggggttcaaattctggttga) and reverse primer (5′ctaggcgaggagctccagt) [4]. A 75-year-old woman was referred to our center because she was affected by acute myeloid leukemia asso- ciated with acute diverticulitis complicated by perforation and abdominal abscesses. The patient presented with a moderate leukopenia and macrocytic anemia (leukocytes: *Corresponding author: Francesco Pallotti, MD, PhD, Dipartimento di Medicina e Chirurgia, Università degli Studi dell’Insubria, Via Guicciardini 9, 21100 Varese, Italy; and SSD Laboratorio Analisi – SMEL Specializzato in Citogenetica e Genetica Medica, ASST Settelaghi, Ospedale di Circolo – Fondazione Macchi, Varese, Italy, Phone: +39-0332-397141, E-mail: francesco.pallotti@uninsubria.it Raffaella Accetta, Lorenzo Elli and Rosario Casalone: SSD Laboratorio Analisi – SMEL Specializzato in Citogenetica e Genetica Medica, ASST Settelaghi, Ospedale di Circolo – Fondazione Macchi, Varese, Italy Leonardo Campiotti: UO Medicina 1, ASST Settelaghi, Ospedale di Circolo – Fondazione Macchi, Varese, Italy; and Dipartimento di Medicina e Chirurgia, Università degli Studi dell’Insubria, Varese, Italy Brought to you by | University of Sussex Library Authenticated Download Date | 7/29/18 8:30 AM